SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g05470): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g05470): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g05470

Feature Type:gene_model
Chromosome:Gm07
Start:4115193
stop:4117534
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G54160AT Annotation by Michelle Graham. TAIR10: O-methyltransferase 1 | chr5:21982075-21984167 FORWARD LENGTH=363 SoyBaseE_val: 6.00E-129ISS
GO:0006598GO-bp Annotation by Michelle Graham. GO Biological Process: polyamine catabolic process SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009698GO-bp Annotation by Michelle Graham. GO Biological Process: phenylpropanoid metabolic process SoyBaseN/AISS
GO:0009805GO-bp Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process SoyBaseN/AISS
GO:0009809GO-bp Annotation by Michelle Graham. GO Biological Process: lignin biosynthetic process SoyBaseN/AISS
GO:0009963GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0042398GO-bp Annotation by Michelle Graham. GO Biological Process: cellular modified amino acid biosynthetic process SoyBaseN/AISS
GO:0051555GO-bp Annotation by Michelle Graham. GO Biological Process: flavonol biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0030744GO-mf Annotation by Michelle Graham. GO Molecular Function: luteolin O-methyltransferase activity SoyBaseN/AISS
GO:0030755GO-mf Annotation by Michelle Graham. GO Molecular Function: quercetin 3-O-methyltransferase activity SoyBaseN/AISS
GO:0033799GO-mf Annotation by Michelle Graham. GO Molecular Function: myricetin 3'-O-methyltransferase activity SoyBaseN/AISS
GO:0047763GO-mf Annotation by Michelle Graham. GO Molecular Function: caffeate O-methyltransferase activity SoyBaseN/AISS
KOG3178 KOG Hydroxyindole-O-methyltransferase and related SAM-dependent methyltransferases JGI ISS
PTHR11746Panther O-METHYLTRANSFERASE JGI ISS
PF00891PFAM O-methyltransferase JGI ISS
PF08100PFAM Dimerisation domain JGI ISS
UniRef100_C6TJM0UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TJM0_SOYBN SoyBaseE_val: 0ISS
UniRef100_D3JZ18UniRef Annotation by Michelle Graham. Most informative UniRef hit: O-methyltransferase-like protein n=1 Tax=Prunus mume RepID=D3JZ18_PRUMU SoyBaseE_val: 1.00E-161ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g05470 not represented in the dataset

Glyma07g05470 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g048800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma07g05470.1   sequence type=CDS   gene model=Glyma07g05470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAAGAAAAAAGCTTCACCTATGCAATGCAGCTGGTGAACTCTAGCGTGCTATCCATGGCCATGCACTCAGCCATAGAGCTTGGCATTTTTGACATCATAGCCAAAGCAGGTGAAGGTGCCAAATTATCTGCCAAGGACATTGCAGCCAAGCTTCCATGCAAGAATTCAGAAGGAGCCACAATGTTGGATCGTATCCTAAGGCTCCTAGTATGTCACTCCATCATTGACTGCACAGTGGTTGCTGATCAACAACATGGTCCTCCTCCACATCTGCAACGGTTCTATGCCATGAACCCTGTGGCCAAATACTTTGCTTCCATTGATGGTGCTGGCTCACTAGGCCCTTTGATGGTCTTGACTCAGGACAAGGCCCTCCTTCATAGTTGGTACCAATTGAAAGATGCAATTCTAGAAGGAGGTATTCCTTTCAACAGGGTTCATGGAAAACACGTGTTTGAATATTCCGACATGAACTCGAGCTTCAATCAGCTTTTCATGGCAGCTATGACAAACCGTGCAACTTTAATAATGAAGAAGATTGTTGAATCCTACAAGGGGTTTGAGCACCTCAATAGCCTGGTGGACGTTGGAGGTGGCCTTGGTGTCACACTTAACATAGTCACTTCTAAATACCCTCACATTAAGGGTATCAATTTTGACTTGCCACATGTCATAGAACATGCCTCTACCTATCCTGGTGTTGAGCATGTGGGAGGAGATATGTTTGAAAGTGTGCCACAAGGAGATGCCATTTTGATGATGTGTGTACTTCATGATTGGAGTGATGAATGGTGCTTGAAGGTATTAAAGAATTGTTATGCTTCTATTCCTAGTGATGGAAAGGTGATTGTTGTGGATGGAATTCTTCCATTTGAACCAAAGACAACAGGTGCATCAAAGAGCATTTCCCAATTTGATGTACTGATGATGACTACAAACCCAGGAGGGAAGGAGCGAAGTGAAGAGGAATTCATGGCATTGGCAAAAGGAGCTGGATACAGTGGCATTAGATTCACATGCTTTGTCTCTGACTTATGGGTTATGGAGTTCTTCAAGTAA

>Glyma07g05470.1   sequence type=predicted peptide   gene model=Glyma07g05470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEEKSFTYAMQLVNSSVLSMAMHSAIELGIFDIIAKAGEGAKLSAKDIAAKLPCKNSEGATMLDRILRLLVCHSIIDCTVVADQQHGPPPHLQRFYAMNPVAKYFASIDGAGSLGPLMVLTQDKALLHSWYQLKDAILEGGIPFNRVHGKHVFEYSDMNSSFNQLFMAAMTNRATLIMKKIVESYKGFEHLNSLVDVGGGLGVTLNIVTSKYPHIKGINFDLPHVIEHASTYPGVEHVGGDMFESVPQGDAILMMCVLHDWSDEWCLKVLKNCYASIPSDGKVIVVDGILPFEPKTTGASKSISQFDVLMMTTNPGGKERSEEEFMALAKGAGYSGIRFTCFVSDLWVMEFFK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo