Report for Sequence Feature Glyma07g05250
Feature Type: gene_model
Chromosome: Gm07
Start: 3902288
stop: 3905718
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma07g05250
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G54770 AT
Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr3:20273863-20275827 REVERSE LENGTH=261
SoyBase E_val: 2.00E-57 ISS
GO:0000398 GO-bp
Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome
SoyBase N/A ISS
GO:0009414 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to water deprivation
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0009737 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus
SoyBase N/A ISS
GO:0010029 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of seed germination
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0000166 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleotide binding
SoyBase N/A ISS
GO:0003676 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding
SoyBase N/A ISS
GO:0003723 GO-mf
Annotation by Michelle Graham. GO Molecular Function: RNA binding
SoyBase N/A ISS
KOG0149
KOG
Predicted RNA-binding protein SEB4 (RRM superfamily)
JGI ISS
PTHR24011 Panther
FAMILY NOT NAMED
JGI ISS
PTHR24011:SF26 Panther
SUBFAMILY NOT NAMED
JGI ISS
PF00076 PFAM
RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)
JGI ISS
UniRef100_B9SD37 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RNA-binding region-containing protein, putative n=2 Tax=core eudicotyledons RepID=B9SD37_RICCO
SoyBase E_val: 5.00E-87 ISS
UniRef100_I1KHK5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KHK5_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma07g05250
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma07g05250
Paralog Evidence Comments
Glyma16g01780 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma07g05250 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.07g046900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma07g05250
Coding sequences of Glyma07g05250
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma07g05250.1 sequence type=CDS gene model=Glyma07g05250 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGACGATGATGAGCAGCAACAACAACAACAACAACAACAACGTTGGAGAATTTGGAGACACCACTCTGACTAAGGTTTTTGTTGGGGGCTTAGCTTGGGAGACTCCGAAGGATGCCCTCAAAGACCACTTTGAGAAGTATGGTGAGATCCTTGAAGCTGTCATCATTTCCGATAAGCACACTGCCAAATCCAAAGGCTATGGCTTTGTGACTTTCAAGGAGGCTGAGGCTGCCAAGAAGGCTTGTGAGGATTCAGCAACTCTCGTTATCAATGGCCGTCGAGCAAATTGCAATCTTGCTTGCCTAGGTGCTCGTCGCCCAAGGTCTTCTTCCAATGTTTCACCACCTCCACAACCACAAGGAGGATCAAACGGTGGAGTAGTGAAGAACAATGCATCAAGCCCACCAGCCATTAATCACGTGCAGCCATATTATTATCCAGTGAGGACAACTGCTGCTCTGCCATTCCATAATCACACTCTTCCTTTCTATGGGTATGCGCCTACCTACATTGTGACGGACGTAAACTACAATTACAATCAGAAACTGTGCTATGGTAGCGGTGGGACCTACATGAATGGGCAGCATGTGTACCCGAGGCAGGCTATTGTGGGTGCCAACACACTGATGCCAATGTACCCTCTTTATCAGTATCATCATCCAACGGAGACCATAGGTGTACCAGCTCACAACTTTTATCCAACGGCATCATGGGCCCCAATGACCATCATGTCCAAGCCATCGTCTATCGTTCCTCATACAGGTACAGTTGGCACAGGTGAGTGCTTTAAAAGGGTTGTCTGA
Predicted protein sequences of Glyma07g05250
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma07g05250.1 sequence type=predicted peptide gene model=Glyma07g05250 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MTMMSSNNNNNNNNVGEFGDTTLTKVFVGGLAWETPKDALKDHFEKYGEILEAVIISDKHTAKSKGYGFVTFKEAEAAKKACEDSATLVINGRRANCNLACLGARRPRSSSNVSPPPQPQGGSNGGVVKNNASSPPAINHVQPYYYPVRTTAALPFHNHTLPFYGYAPTYIVTDVNYNYNQKLCYGSGGTYMNGQHVYPRQAIVGANTLMPMYPLYQYHHPTETIGVPAHNFYPTASWAPMTIMSKPSSIVPHTGTVGTGECFKRVV*