SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma07g04650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma07g04650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma07g04650

Feature Type:gene_model
Chromosome:Gm07
Start:3448251
stop:3450985
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma07g04650
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14110AT Annotation by Michelle Graham. TAIR10: Tetratricopeptide repeat (TPR)-like superfamily protein | chr3:4676222-4677010 REVERSE LENGTH=232 SoyBaseE_val: 4.00E-118ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0000304GO-bp Annotation by Michelle Graham. GO Biological Process: response to singlet oxygen SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009416GO-bp Annotation by Michelle Graham. GO Biological Process: response to light stimulus SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0015994GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll metabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019216GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of lipid metabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031408GO-bp Annotation by Michelle Graham. GO Biological Process: oxylipin biosynthetic process SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR10098Panther RAPSYN JGI ISS
PTHR10098:SF31Panther FLU (FLUORESCENT IN BLUE LIGHT), BINDING JGI ISS
UniRef100_G7L8A8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Tetratricopeptide repeat protein n=1 Tax=Medicago truncatula RepID=G7L8A8_MEDTR SoyBaseE_val: 1.00E-173ISS
UniRef100_I1KHE4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KHE4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma07g04650
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma07g04650 not represented in the dataset
Glyma07g04650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g04650
ParalogEvidenceComments
Glyma16g01240 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g04650 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.07g041700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma07g04650
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Transcripts of Glyma07g04650
>Glyma07g04650.2   sequence type=transcript   gene model=Glyma07g04650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCACATAGTAAGTTGTGATTCAGCAAACAAAGATACAGACACAGATTGTTATCCCAACGTTTTATCCTTTCAGTTACAGCTTTCAGCTCACCGAACTAACTCAACTCATGGCGGTGCTCATCCGTTGCTCTTGTTTCCTCACTCGCCCTCGCTTCTCACAACCTCAATTCTACGCCAACAACACCAAACCCGTACTCCCAGGAAAATTAGCTTGTCTTTCTCTAAAACGGGACAAGGGTGTTCCACACTTTGTAGACACGTTTGATGGATCTTCTAAGATTCCGAGTTTGCTGCACTGCTCAAAGTGTAAGGTATGATGGAAGACATACACCAAAGGTTCCCGTCACTGATATTTGTAGCGAGCAATATTTTGATGTTCTCTATGCCTAACACAGCCTTGGCTGAAACGTGTGAGGCTGATACCTCTGTTTTCAATATGCCTATACTGCTGGCAGTAGCCCTTATTGGAGCCACAGTTGGAGGGTTGCTCGCTCGGCAAAGAAGGAATGAATTACAACGGGTAAACGAGCAATTGATCCAAATCAACTCAGCTTTAAGGAAGCAAGCCAAAATTGAGTCCTATGCCCCTAGCTTGAGTTATGCTCCCATTGGCGGTGGTAGGATACTTGATAATGAAATTATTGTTAACCCAAAGAAGCAGGAGCTAATTTCGAAGTTGAAAAATGGAAAGAACTTTCTAAGGAATCAACGACCAGATAAAGCATTCACGGAGTTTAAGAATGCACTTGAGCTTGCCCAGAATCTAAAAGATCCTATTGAAGAGAAAAAAGCTGCTAGAGGTCTAGGAGCCTCACTACAAAGACAGGGAAAATACAGAGATGCTATTAAATATCATTCCATGGTTCTGGCCATCTCTGAACGGGAAGGAGAAGACTCAGGGAGTACAGAAGCTTTTGGGGCAATTGCTGATTGTTACACTGAGCTTGGAGAGCTTGAGAAAGCAGGCCAATTCTATGACAAGTATATTGCAAGACTGGAAAAGGACTAATCTTTGACACGTTTAACATTTCTGAGAGAAATAACCAGTGTTGGATTACTAGACTTTCATCATGGCTTGTCACCATCTGTTCTTCATGCGGATTTTCCTTTTTCTTTTTGATCCTCTCTTTGGAACTTAAGATTATTCAGTTCCTATTTATTTTTTGGTTGGAAATACTTAAAGCATATGTGTTTCCAAGATTGCGAAATATTAGTCCTTTAGATGAGTAAGGGAAATATTTGTGTGCATCTACATTTCTATTGTGCTTCTCTTACACCAGTATATTTGGCCATTATCAAAACATTAACAAATTATCATTTCGCCATTACTTTTTATTTTGATCGATCAGATAAGGAAATTTATTCGAAAAT
Coding sequences of Glyma07g04650
>Glyma07g04650.1   sequence type=CDS   gene model=Glyma07g04650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGTGCTCATCCGTTGCTCTTGTTTCCTCACTCGCCCTCGCTTCTCACAACCTCAATTCTACGCCAACAACACCAAACCCGTACTCCCAGGAAAATTAGCTTGTCTTTCTCTAAAACGGGACAAGGGTGTTCCACACTTTGTAGACACGTTTGATGGATCTTCTAAGATTCCGAGTTTGCTGCACTGCTCAAAGTGTAAGGAAGACATACACCAAAGGTTCCCGTCACTGATATTTGTAGCGAGCAATATTTTGATGTTCTCTATGCCTAACACAGCCTTGGCTGAAACGTGTGAGGCTGATACCTCTGTTTTCAATATGCCTATACTGCTGGCAGTAGCCCTTATTGGAGCCACAGTTGGAGGGTTGCTCGCTCGGCAAAGAAGGAATGAATTACAACGGGTAAACGAGCAATTGATCCAAATCAACTCAGCTTTAAGGAAGCAAGCCAAAATTGAGTCCTATGCCCCTAGCTTGAGTTATGCTCCCATTGGCGGTGGTAGGATACTTGATAATGAAATTATTGTTAACCCAAAGAAGCAGGAGCTAATTTCGAAGTTGAAAAATGGAAAGAACTTTCTAAGGAATCAACGACCAGATAAAGCATTCACGGAGTTTAAGAATGCACTTGAGCTTGCCCAGAATCTAAAAGATCCTATTGAAGAGAAAAAAGCTGCTAGAGGTCTAGGAGCCTCACTACAAAGACAGGGAAAATACAGAGATGCTATTAAATATCATTCCATGGTTCTGGCCATCTCTGAACGGGAAGGAGAAGACTCAGGGAGTACAGAAGCTTTTGGGGCAATTGCTGATTGTTACACTGAGCTTGGAGAGCTTGAGAAAGCAGGCCAATTCTATGACAAGTATATTGCAAGACTGGAAAAGGACTAA

>Glyma07g04650.2   sequence type=CDS   gene model=Glyma07g04650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGGAAGACATACACCAAAGGTTCCCGTCACTGATATTTGTAGCGAGCAATATTTTGATGTTCTCTATGCCTAACACAGCCTTGGCTGAAACGTGTGAGGCTGATACCTCTGTTTTCAATATGCCTATACTGCTGGCAGTAGCCCTTATTGGAGCCACAGTTGGAGGGTTGCTCGCTCGGCAAAGAAGGAATGAATTACAACGGGTAAACGAGCAATTGATCCAAATCAACTCAGCTTTAAGGAAGCAAGCCAAAATTGAGTCCTATGCCCCTAGCTTGAGTTATGCTCCCATTGGCGGTGGTAGGATACTTGATAATGAAATTATTGTTAACCCAAAGAAGCAGGAGCTAATTTCGAAGTTGAAAAATGGAAAGAACTTTCTAAGGAATCAACGACCAGATAAAGCATTCACGGAGTTTAAGAATGCACTTGAGCTTGCCCAGAATCTAAAAGATCCTATTGAAGAGAAAAAAGCTGCTAGAGGTCTAGGAGCCTCACTACAAAGACAGGGAAAATACAGAGATGCTATTAAATATCATTCCATGGTTCTGGCCATCTCTGAACGGGAAGGAGAAGACTCAGGGAGTACAGAAGCTTTTGGGGCAATTGCTGATTGTTACACTGAGCTTGGAGAGCTTGAGAAAGCAGGCCAATTCTATGACAAGTATATTGCAAGACTGGAAAAGGACTAA
Predicted protein sequences of Glyma07g04650
>Glyma07g04650.1   sequence type=predicted peptide   gene model=Glyma07g04650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVLIRCSCFLTRPRFSQPQFYANNTKPVLPGKLACLSLKRDKGVPHFVDTFDGSSKIPSLLHCSKCKEDIHQRFPSLIFVASNILMFSMPNTALAETCEADTSVFNMPILLAVALIGATVGGLLARQRRNELQRVNEQLIQINSALRKQAKIESYAPSLSYAPIGGGRILDNEIIVNPKKQELISKLKNGKNFLRNQRPDKAFTEFKNALELAQNLKDPIEEKKAARGLGASLQRQGKYRDAIKYHSMVLAISEREGEDSGSTEAFGAIADCYTELGELEKAGQFYDKYIARLEKD*

>Glyma07g04650.2   sequence type=predicted peptide   gene model=Glyma07g04650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMEDIHQRFPSLIFVASNILMFSMPNTALAETCEADTSVFNMPILLAVALIGATVGGLLARQRRNELQRVNEQLIQINSALRKQAKIESYAPSLSYAPIGGGRILDNEIIVNPKKQELISKLKNGKNFLRNQRPDKAFTEFKNALELAQNLKDPIEEKKAARGLGASLQRQGKYRDAIKYHSMVLAISEREGEDSGSTEAFGAIADCYTELGELEKAGQFYDKYIARLEKD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo