Glyma07g01650 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma07g01650

Feature Type:	gene_model
Chromosome:	Gm07
Start:	1078684
stop:	1079805
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma07g01650

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G21350	AT	Annotation by Michelle Graham. TAIR10: RNA polymerase transcriptional regulation mediator-related \| chr3:7517106-7518587 FORWARD LENGTH=257	SoyBase	E_val: 4.00E-20	ISS
GO:0006357	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription from RNA polymerase II promoter	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0016592	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mediator complex	SoyBase	N/A	ISS
UniRef100_B9RQ93	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: RNA polymerase II mediator complex subunit, putative n=1 Tax=Ricinus communis RepID=B9RQ93_RICCO	SoyBase	E_val: 7.00E-26	ISS
UniRef100_I1KGG6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1KGG6_SOYBN	SoyBase	E_val: 4.00E-58	ISS

Expression Patterns of Glyma07g01650

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma07g01650

Paralog	Evidence	Comments
Glyma08g21290	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma07g01650 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma07g01650

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma07g01650

Limit To All Plant Sequences

>Glyma07g01650.1   sequence type=CDS   gene model=Glyma07g01650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGGTCAGTTGATTCTGAAAACGGGACTGCTTTGCTGGAGTCAAAGACTGCTAAGGAGACAATCGACATAAAGGAAGCTAAGCGAGTGGATCATATTCTTACATCCTTGCAACGCAGGTTACCACCAGCTCCTCCTCCACCACCATTTCCAGAAGGGTATGTTTCACCTCTAACAGCAGAAACTGAGAAAGGCACTGAAACTCAGGAAGCAGCAGAAACGCAAGCTCCTACTGCTGATCCCATAATTGATCAAGGACCAGCAAAAAGAATGAAATTTTGA

Predicted protein sequences of Glyma07g01650

Limit To All Plant Sequences

>Glyma07g01650.1   sequence type=predicted peptide   gene model=Glyma07g01650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GSVDSENGTALLESKTAKETIDIKEAKRVDHILTSLQRRLPPAPPPPPFPEGYVSPLTAETEKGTETQEAAETQAPTADPIIDQGPAKRMKF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain