SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g47520): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g47520): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g47520

Feature Type:gene_model
Chromosome:Gm06
Start:49939469
stop:49941902
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40770AT Annotation by Michelle Graham. TAIR10: prohibitin 3 | chr5:16315589-16316621 REVERSE LENGTH=277 SoyBaseE_val: 1.00E-171ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006626GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion SoyBaseN/AISS
GO:0007005GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrion organization SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0048527GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root development SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0071731GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitric oxide SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005747GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex I SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
KOG3083 KOG Prohibitin JGI ISS
PTHR23222Panther PROHIBITIN JGI ISS
PF01145PFAM SPFH domain / Band 7 family JGI ISS
UniRef100_G7IVL7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Prohibitin n=2 Tax=Medicago truncatula RepID=G7IVL7_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KFR0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KFR0_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g47520 not represented in the dataset

Glyma06g47520 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g16350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g317500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g47520.1   sequence type=CDS   gene model=Glyma06g47520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGCAACCAAGCCGCCATTTCCTTCCTCACCAACGTCGCCCGCGCGGCCTTCGGCCTTGGCGCGGCGGCCACCGCCCTCTCCTCCTCCCTCTACACCGTGGACGGCGGGCAGCGCGCCGTCCTCTTCGACCGGTTCCGCGGCATCCTGGACTCCACCGTCGGCGAGGGGACCCACTTCCTGGTCCCATGGGTCCAGAAACCCTACATCTTCGACATCCGCACTCGCCCCCACACATTCTCCTCGGTCTCCGGCACAAAGGATCTTCAAATGGTTAACCTAACCCTCCGCGTCCTCTCCCGCCCCGACACCGAGAAGCTCCCCACCATCGTCCAGAACCTCGGCCTCGAATACGACGAGAAAGTCCTCCCGTCGATCGGCAATGAGGTTCTGAAAGCCGTCGTGGCGCAATTCAACGCCGATCAGCTCCTCACGGACCGCTCACAGGTCTCCGCCCTCGTCCGCGAGAGCTTGATCCGTCGCGCCAGAGACTTCAATATCGTTCTTGATGATGTGGCGATCACTCACCTCTCCTACGGCGGGGAATTCTCCCGCGCCGTGGAGCAGAAGCAGGTGGCGCAGCAGGAGGCCGAGAGGTCCAAGTTTGTTGTGATGAAGGCCGAGCAGGAGCGGAGGGCCGCCATTATTAGGGCCGAGGGTGAGAGTGATGCGGCCAAGCTGATCTCGGACGCCACGGCCTCCGCCGGGATGGGGCTCATCGAGCTCCGGAGGATCGAGGCGTCCAGGGAGGTTGCGGCTACGCTCGCCAAGTCGCCTAATGTTTCGTACTTGCCCGGTGGACAGAACTTGCTCATGGCTCTCGGTCCTTCCCGCTGA

>Glyma06g47520.1   sequence type=predicted peptide   gene model=Glyma06g47520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSNQAAISFLTNVARAAFGLGAAATALSSSLYTVDGGQRAVLFDRFRGILDSTVGEGTHFLVPWVQKPYIFDIRTRPHTFSSVSGTKDLQMVNLTLRVLSRPDTEKLPTIVQNLGLEYDEKVLPSIGNEVLKAVVAQFNADQLLTDRSQVSALVRESLIRRARDFNIVLDDVAITHLSYGGEFSRAVEQKQVAQQEAERSKFVVMKAEQERRAAIIRAEGESDAAKLISDATASAGMGLIELRRIEASREVAATLAKSPNVSYLPGGQNLLMALGPSR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo