SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g47280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g47280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g47280

Feature Type:gene_model
Chromosome:Gm06
Start:49787368
stop:49790449
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g47280
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G04910AT Annotation by Michelle Graham. TAIR10: unknown protein; Has 71 Blast hits to 71 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). | chr5:1437695-1438770 FORWARD LENGTH=222 SoyBaseE_val: 5.00E-84ISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_I1KFN6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KFN6_SOYBN SoyBaseE_val: 2.00E-155ISS
UniRef100_Q9FF82UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dbj|BAA90353.1 n=1 Tax=Arabidopsis thaliana RepID=Q9FF82_ARATH SoyBaseE_val: 9.00E-76ISS

Expression Patterns of Glyma06g47280
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g47280 not represented in the dataset
Glyma06g47280 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g47280
ParalogEvidenceComments
Glyma04g16005 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g47280 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g315000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g47280
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g47280
>Glyma06g47280.1   sequence type=CDS   gene model=Glyma06g47280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGGCGAGTGAGCGAGCGATGGAAGAAGAAGATTTTGATTTCGAGAAGAAGGTTTCGATAAAGGAATCGATGTCGATGTCGATGTCGACAGAGCTTGATCCAGCCAAAGTTCTTCTTTTGCTTCGTGGTTTCCTCCAAATTCAGCAACGCAGGGCCGAAGCATATTCTAAGCTCAAAAGTGGGTTTTCTGACTACATGGCCTCTGGAGGGGAATTGGCTTACAAGCAGCTCTGCAGTGAAATCACAATAGAGTTTAACAATTGCTCGAAAAAAGTCCTTGAAATGGAGTCACTGTTTAGAAGCCCTGATTACTGCCGAGTTGATCTAGCGCAGCTCCTTAGAGCTGTTCAAGATCAGGAAAAGCAGAAACTTCAACTGACTGCCACCATTCAGGTGTTAAAGAAAGCCGGTCGCCCATCTGAACGTCTGGTAAGCCATGAGAATTGCAAATTTACAAAGCCAGCAGAGCATGAGTGCGTTCATGTTCAGGAGATTACAGAAGCTTCTGGGACTGAAGAAGCTGAAGCAGATGCTGAGTATGACAATGCTCTAAAAGAAGCTATTAGAGGTGTCCAGGATGCTGTCATGGCCATTAATGAACATCTAGAAGAAGTCAGATATGAAATTGCTGCCCTTGAAGCAGAGTGA
Predicted protein sequences of Glyma06g47280
>Glyma06g47280.1   sequence type=predicted peptide   gene model=Glyma06g47280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVASERAMEEEDFDFEKKVSIKESMSMSMSTELDPAKVLLLLRGFLQIQQRRAEAYSKLKSGFSDYMASGGELAYKQLCSEITIEFNNCSKKVLEMESLFRSPDYCRVDLAQLLRAVQDQEKQKLQLTATIQVLKKAGRPSERLVSHENCKFTKPAEHECVHVQEITEASGTEEAEADAEYDNALKEAIRGVQDAVMAINEHLEEVRYEIAALEAE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo