SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g46730

Feature Type:gene_model
Chromosome:Gm06
Start:49310081
stop:49312576
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g46730
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G17600AT Annotation by Michelle Graham. TAIR10: RING/U-box superfamily protein | chr5:5800029-5801117 REVERSE LENGTH=362 SoyBaseE_val: 7.00E-62ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR14155Panther RING FINGER PROTEIN 6/12/38 JGI ISS
PTHR14155:SF30Panther OS02G0692000 PROTEIN JGI ISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
UniRef100_B9SNU8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ring finger protein, putative n=1 Tax=Ricinus communis RepID=B9SNU8_RICCO SoyBaseE_val: 8.00E-62ISS
UniRef100_I1KFJ5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KFJ5_SOYBN SoyBaseE_val: 4.00E-166ISS

Expression Patterns of Glyma06g46730
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g46730
ParalogEvidenceComments
Glyma04g15820 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g46730 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g310600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g46730
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g46730
>Glyma06g46730.1   sequence type=CDS   gene model=Glyma06g46730   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTCTATGAGTAACTCAAATCCAAATCCATGGACTCCAAAGGATTGTTCTGAAGGAATTTGTAGCATCTATTGTCCTCAGTGGTGTTACATAGTGTACTCTCCTCCTACTCCAATTCTACTAGGTGATGGTGATGATGACCCTTCTGGATTTGAATTCTCTCCTCTCATAGTTGCTGCGATTGGAATCTTGGCTAGTACTTTCATCTTGGTCACTTACTATACCATTATCTCAAGGTTATGCAGGCAAAGACACAACACAAATGATCCAACAGAAGACGATGGAAACAGCGAATTGGCGCGAATTTCTTCGTCTGCCAATTCTGGTTTGGATGAGGCTCTCATCAAATCCATCAGGGTTTGCAAGTACAACAAGGGTGGTGGGTTGGTGGAAGGTCACGATTGTTCGGTTTGTTTGATCGAGTTCCAAGAGAATGAAAACTTGAGATTGTTGCCAAAATGCAACCATGCTTTTCATCTCCCTTGCATTGATACTTGGCTCAAGTCTCATGCTACTTGCCCTTTGTGTCGTTCTTCTGTCACCGCTTGTCCAAATCCGAATCCAAATTCTTCCATGGAACCCCCACCAAGAGTCATTGTTAATGCCTTGGGACACCAACTTAGGAGTAACCATGTTGTTGTTGTTGAGAGTTCTGAGGAACAACAGAAAGATGGTTAG
Predicted protein sequences of Glyma06g46730
>Glyma06g46730.1   sequence type=predicted peptide   gene model=Glyma06g46730   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSMSNSNPNPWTPKDCSEGICSIYCPQWCYIVYSPPTPILLGDGDDDPSGFEFSPLIVAAIGILASTFILVTYYTIISRLCRQRHNTNDPTEDDGNSELARISSSANSGLDEALIKSIRVCKYNKGGGLVEGHDCSVCLIEFQENENLRLLPKCNHAFHLPCIDTWLKSHATCPLCRSSVTACPNPNPNSSMEPPPRVIVNALGHQLRSNHVVVVESSEEQQKDG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo