SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g43811

Feature Type:gene_model
Chromosome:Gm06
Start:46820813
stop:46821403
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g43811
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G06280AT Annotation by Michelle Graham. TAIR10: LOB domain-containing protein 2 | chr1:1920327-1920947 REVERSE LENGTH=206 SoyBaseE_val: 1.00E-36ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
PF03195PFAM Protein of unknown function DUF260 JGI ISS
UniRef100_B9SGN1UniRef Annotation by Michelle Graham. Most informative UniRef hit: LOB, putative n=1 Tax=Ricinus communis RepID=B9SGN1_RICCO SoyBaseE_val: 1.00E-40ISS
UniRef100_I1LS97UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1LS97_SOYBN SoyBaseE_val: 1.00E-83ISS

Expression Patterns of Glyma06g43811
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g43811 not represented in the dataset
Glyma06g43811 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g43811
ParalogEvidenceComments
Glyma12g14101 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g43811 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g285100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g43811
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g43811
>Glyma06g43811.1   sequence type=CDS   gene model=Glyma06g43811   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAAGAAATAATAGTGGAATGCATCCAGCATGTGCAGCATGCAAGCATCAAAGGAAGAAATGCAGTGAAAACTGTATATTGGGACCTTACTTTCCATCAAATAAAAACCAAGAGTTCCATGCTGTGCACAAGGTTTTTGGTGTTAGCAACATTACCAAGTTGGTAAAGAATGCTAAAACGGAAGATAGAAGAAAAGTTGTGGACTCATTGATATGGGAAGCATGTTGTAGGCAAAGGGACCCTATACAAGGTCCTTATGGAGAGTACACAAAAGTTTACAACGAGTATAAGAAAGTGTTGGATGAACTTAAGAGATTCAAAAGCCAAAACCAGCTTTTGCAAATTCCCTCTCTAGGATTAAAGTCTGTACAAGGTTTGATTACTTGCAGTGAAACCAAAGGGGAACACAAAGCGACCATTGATAGTGCGTTGGATTATCTTCATGGGAAAAAGAATGGTATTATTGATTCTGATAATTATAATACTTATTGTTCGAATTATTTGCAAGAGTTTCAAAATATGAGGCCTGAAGTTGTCATACCGTTTCGACAACACTCTCAATCATACTACACTACAGGTATCAATTAA
Predicted protein sequences of Glyma06g43811
>Glyma06g43811.1   sequence type=predicted peptide   gene model=Glyma06g43811   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQRNNSGMHPACAACKHQRKKCSENCILGPYFPSNKNQEFHAVHKVFGVSNITKLVKNAKTEDRRKVVDSLIWEACCRQRDPIQGPYGEYTKVYNEYKKVLDELKRFKSQNQLLQIPSLGLKSVQGLITCSETKGEHKATIDSALDYLHGKKNGIIDSDNYNTYCSNYLQEFQNMRPEVVIPFRQHSQSYYTTGIN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo