Glyma06g43701 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g43701

Feature Type:	gene_model
Chromosome:	Gm06
Start:	46724655
stop:	46727498
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g43701

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G38080	AT	Annotation by Michelle Graham. TAIR10: Laccase/Diphenol oxidase family protein \| chr2:15934540-15937352 FORWARD LENGTH=558	SoyBase	E_val: 0	ISS
GO:0009809	GO-bp	Annotation by Michelle Graham. GO Biological Process: lignin biosynthetic process	SoyBase	N/A	ISS
GO:0009834	GO-bp	Annotation by Michelle Graham. GO Biological Process: secondary cell wall biogenesis	SoyBase	N/A	ISS
GO:0010413	GO-bp	Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process	SoyBase	N/A	ISS
GO:0045492	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process	SoyBase	N/A	ISS
GO:0046274	GO-bp	Annotation by Michelle Graham. GO Biological Process: lignin catabolic process	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0052716	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydroquinone:oxygen oxidoreductase activity	SoyBase	N/A	ISS
KOG1263	KOG	Multicopper oxidases	JGI		ISS
PTHR11709	Panther	MULTI-COPPER OXIDASE	JGI		ISS
PTHR11709:SF9	Panther	LACCASE	JGI		ISS
PF00394	PFAM	Multicopper oxidase	JGI		ISS
PF07731	PFAM	Multicopper oxidase	JGI		ISS
PF07732	PFAM	Multicopper oxidase	JGI		ISS
UniRef100_G7KE42	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Laccase 1a n=1 Tax=Medicago truncatula RepID=G7KE42_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233988E	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233988E related cluster n=1 Tax=unknown RepID=UPI000233988E	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g43701

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g43701 not represented in the dataset	Glyma06g43701 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g43701

Paralog	Evidence	Comments
Glyma12g14230	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g43701 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g284300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g43701

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g43701

Limit To All Plant Sequences

>Glyma06g43701.1   sequence type=CDS   gene model=Glyma06g43701   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTATTGCTGGCAGCTTGCTTGCTTCCACTATCTGGGGAAGCTATGGTTCGCTACTACAAGTTCAATGTAGTCTATAACTTTACTCTTACAGGCCAAAGAGGCACACTTTGGTGGCATGCACATATCCTCTGGCTTAGGGCCACTGTCCATGGTGCCTTGGTCATCTTGCCCAAGCTTGGAGTTCCGTACCCTTTTCCCAAACCAAATAGGGAACAAGTTATCATATTGAGTGAATGGTGGAAATCAGATACTGAGGCTGTAATAAATGAAGCTTTGAAATCCGGTTTGGCTCCAAATGTCTCTGATGCTCACACAATCAATGGCCATCCAGGACCTATCCAAGGCTGGTTTAAGTTGGATGTTCAACCAGGAAACACCTACTTGCTAAGAATCATCAATGCTGCACTCAATGAAGAGCTCTTTTTTAAAATTGCTGGCCATGAACTCACAGTTGTTGAGGTTGATGCAGTCTACACCAAGCCTTTCAAAACTGATACCATTCTCATAGCACCTGGCCAAACCACAAATGTGCTTCTAACAACCAAACATGAAACTGGCAAATACTTGACTGCCACTGCCACTTTACACTATCTAGGCACCCTTGGTTCCACCATCACCACCCTCACTTCAATGCCTCCTAGAAATGCAACACCACTTGCCACCACTTTCACCGATTCTCTCCGAAGCTTAAACTCCGAAAAGTATCCTGCTAGAGTCCCTTTAAGGATTGATCATAACTTGCTCTTCACAGTTAGCCTCAGTGTCAACCCTTGTGCTACTTGTGTGAATAATAGCAGGGTGGTAGCAGATATCAACAATGTCACCTTTGTGATGCCTAAAATTTCTCTTCTTCAAGCACATTTCCTCAAGATCAAGGGTGTTTTCACCGATGATTTTCCTGGAAATCCTCCTGTAACCATGAAAGGGACAAGAGTCTATAGACTAGCTTACAATTCCACTGTTCAATTGGTCTTGCAAGATACTGGAATGATAACACCTGAGAACCATCCTATTCATCTTCATGGCATTTTTTTTTTGTTGTTGTTGAAATTCAACCTTGGAGATCCTGTGGAGAAAAATACAGTTGGAGTTCCGGCTGGGGGGTGGACTGCTATCAGATTCAGGGCTGATAATCCAGGACCAAATGAATCTTTATTACCACCTCCAAGCGACCTACCCAAGTGTTGA

Predicted protein sequences of Glyma06g43701

Limit To All Plant Sequences

>Glyma06g43701.1   sequence type=predicted peptide   gene model=Glyma06g43701   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLLLAACLLPLSGEAMVRYYKFNVVYNFTLTGQRGTLWWHAHILWLRATVHGALVILPKLGVPYPFPKPNREQVIILSEWWKSDTEAVINEALKSGLAPNVSDAHTINGHPGPIQGWFKLDVQPGNTYLLRIINAALNEELFFKIAGHELTVVEVDAVYTKPFKTDTILIAPGQTTNVLLTTKHETGKYLTATATLHYLGTLGSTITTLTSMPPRNATPLATTFTDSLRSLNSEKYPARVPLRIDHNLLFTVSLSVNPCATCVNNSRVVADINNVTFVMPKISLLQAHFLKIKGVFTDDFPGNPPVTMKGTRVYRLAYNSTVQLVLQDTGMITPENHPIHLHGIFFLLLLKFNLGDPVEKNTVGVPAGGWTAIRFRADNPGPNESLLPPPSDLPKC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain