Glyma06g41230 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g41230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g41230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g41230

Feature Type:	gene_model
Chromosome:	Gm06
Start:	44515272
stop:	44519124
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g41230

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G20660	AT	Annotation by Michelle Graham. TAIR10: organic cation/carnitine transporter4 \| chr3:7225271-7228510 REVERSE LENGTH=526	SoyBase	E_val: 0	ISS
GO:0006635	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation	SoyBase	N/A	ISS
GO:0006810	GO-bp	Annotation by Michelle Graham. GO Biological Process: transport	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0042631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to water deprivation	SoyBase	N/A	ISS
GO:0046482	GO-bp	Annotation by Michelle Graham. GO Biological Process: para-aminobenzoic acid metabolic process	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009535	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane	SoyBase	N/A	ISS
GO:0009705	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005215	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transporter activity	SoyBase	N/A	ISS
GO:0005351	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0015144	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity	SoyBase	N/A	ISS
GO:0022857	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transmembrane transporter activity	SoyBase	N/A	ISS
KOG0255	KOG	Synaptic vesicle transporter SVOP and related transporters (major facilitator superfamily)	JGI		ISS
PTHR24064	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24064:SF41	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00083	PFAM	Sugar (and other) transporter	JGI		ISS
UniRef100_B9SY49	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Organic cation transporter, putative n=1 Tax=Ricinus communis RepID=B9SY49_RICCO	SoyBase	E_val: 0	ISS
UniRef100_UPI0002339428	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002339428 related cluster n=1 Tax=unknown RepID=UPI0002339428	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g41230

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g41230 not represented in the dataset	Glyma06g41230 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g41230 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g263400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g41230

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g41230

Limit To All Plant Sequences

>Glyma06g41230.2   sequence type=CDS   gene model=Glyma06g41230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGTGCGACGTTGCCCAGCGAATCCAAAGACCGGGGCACCGATCCGTCCCGGTCACCGCTCATTCCAGCGACGGAGAAAAAGCCCGCCGGAGCATCGGCATCGGAGAAGCTATGCATCGACGAGATGCTGCAGAAGTACTGCGGCGAGTTCGGGCGGTGGCAGCTGAAGCACTTCATCTTAACGAGTCTGGCGTGGGCGTTGGAGGCGTTCCACACGATGGTTATCATATTCGCGGACCGCGAGCCGGAGTGGCAGTGCCTCGACGGCGCGGCCGGGTCGGGATGCGACCCGGCCGCGAAGAACGTGTGCCGGTTCGAACCGGGCTCGTGGAAGTGGGTCGGGGACTCCACGGTGGCGGAGTGGGGGCTTTTTTGCGGTGACAAGTTTAAGGTTGGACTGGTTCAGGCCGTATTCTTCGGCGGCTGCATGATCGGTGCTGGAATATTCGGTCACCTCTCAGACTCATTTCTCGGAAGAAAAGGGTCACTCACAGTGGTCTGTGCCCTAAACACCGTATTTGGAACCCTAACGGCCTTTTCTCCCAGCTACTCCTTCTATGTCCTCTTCCGCCTCCTCACCGGCTGCAGCACCGGTGGCGTCGGCCTCTGCGCCTTCGTCCTCGCCACCGAGCCGGTGGGCCCCAAAATGCGCGGTACGGTCGGCATGTCCACCTTCTACTTCTTCTCCTCCGGCATTGCCCTCCTCTCCGCCATCGCCTACATCTTCCCCGCATGGCGCAATCTCTACATAGTCTCCTCCCTCTCCTCCCTCGTCTTCCTCGTCTTCGTCCTCCCCTTCGTCTCGGAGTCCCCGAGATGGTACCTCGTACGAGGAAGAAAATCGGAGGCCATGAAAATCATGTCCACCATCGCCACCTCCAATGGTAACCACCTTCCACAAGGTGTTATTCTCACCATGGACAACCAAGAACCATTATCCTTACCATTATCACCATCATCATTATCATATCATGTGGCAATGACGGGATCTTTACTTGACGTGATCCGCACGCCAATGACACGTGCCCGATTAGTCCTCGCTGTTGTTATCAACTTCTTATGCTCCGTTGTGTACTATGGATTAAGCCTCAACGTGGTGAACCTCGAGACCAACCTCTACCTCACGGTGATCCTCAACGCTGTCGCGGAGATGCCGGCGTTTATGATAACGGCGATGTTACTCGACCGGTGGGGGAGGAAGCCGTTAACCATAGGAACCTTATGGTTCAGCGGTGCATTTTGCTTTGCGGGGAGCTTGGTGAACAACGTTGGGGTGTGGAAAGGTGTGAGAGTGGTGTGTGGGATTTTGGGGATTTTTGGGATGGCGGGGACTTATAATTTGTTGTTTATTTACACGGCGGAGCTGTTCCCGACGGTGGTGAGGAACGCCGCGCTCGGCTGCGCCACGCAGGCGGCGCAGATGGGTGCCATACTGGCGCCGCTGGTTGTCGTTTTGGGTGGGTCGTTGCCGTTTTTGGTGTTCGCTTTGTGCGGAATAGTTGGGGGCGTTTTCGCGTTTTATCTGCCAGAGACCCTGAACCAACCTCTCTATGATACGTTAACTGGAATGGAGGCCAAGGAAAATACTGCTATCTCAACCAAAGTATGA

Predicted protein sequences of Glyma06g41230

Limit To All Plant Sequences

>Glyma06g41230.2   sequence type=predicted peptide   gene model=Glyma06g41230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRATLPSESKDRGTDPSRSPLIPATEKKPAGASASEKLCIDEMLQKYCGEFGRWQLKHFILTSLAWALEAFHTMVIIFADREPEWQCLDGAAGSGCDPAAKNVCRFEPGSWKWVGDSTVAEWGLFCGDKFKVGLVQAVFFGGCMIGAGIFGHLSDSFLGRKGSLTVVCALNTVFGTLTAFSPSYSFYVLFRLLTGCSTGGVGLCAFVLATEPVGPKMRGTVGMSTFYFFSSGIALLSAIAYIFPAWRNLYIVSSLSSLVFLVFVLPFVSESPRWYLVRGRKSEAMKIMSTIATSNGNHLPQGVILTMDNQEPLSLPLSPSSLSYHVAMTGSLLDVIRTPMTRARLVLAVVINFLCSVVYYGLSLNVVNLETNLYLTVILNAVAEMPAFMITAMLLDRWGRKPLTIGTLWFSGAFCFAGSLVNNVGVWKGVRVVCGILGIFGMAGTYNLLFIYTAELFPTVVRNAALGCATQAAQMGAILAPLVVVLGGSLPFLVFALCGIVGGVFAFYLPETLNQPLYDTLTGMEAKENTAISTKV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain