SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g39956

Feature Type:gene_model
Chromosome:Gm06
Start:43015475
stop:43016459
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g39956
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G27170AT Annotation by Michelle Graham. TAIR10: transmembrane receptors;ATP binding | chr1:9434718-9439219 FORWARD LENGTH=1384 SoyBaseE_val: 5.00E-15ISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0043531GO-mf Annotation by Michelle Graham. GO Molecular Function: ADP binding SoyBaseN/AISS
PF01582PFAM TIR domain JGI ISS
UniRef100_C6ZS29UniRef Annotation by Michelle Graham. Most informative UniRef hit: TIR-NBS-LRR type disease resistance protein n=1 Tax=Glycine max RepID=C6ZS29_SOYBN SoyBaseE_val: 3.00E-27ISS
UniRef100_I1KEA3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KEA3_SOYBN SoyBaseE_val: 8.00E-36ISS

Expression Patterns of Glyma06g39956
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g39956 not represented in the dataset
Glyma06g39956 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g39956 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g256100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g39956
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g39956
>Glyma06g39956.1   sequence type=CDS   gene model=Glyma06g39956   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGACATACGATGTTTTTGTCTGCTTCCGCGTCGAAACACGCAACGACTTCAATGGTTTTCTTTTCAAAGCTCTGCGAAGGAAAGGCATTGATGCCTTCAAAGATGATAAAGATATCAGGAAAGTTGCACACCTCTGCAACTGCATTCAAACATCACCAAGACGTGTTGTACCTATTTTTTATGATGTTGATACATCACATGTGCGAAACCAGAGTGGATGTTATGAGATAGCCTTTGCCAAATATGCAGAAAGGCTCAAAGAAGATAAAGAGAATACGGATGAAATGCAGAGATGGAGAGAAGCTCTTACACGAGTGGCCAGTGTCTCTGGTAATCTACTACGTAGGCAGAGGGTGATGCAATTTTCATTATATTTTTTAACAGATTCAAAGCTAATGGACTTTTATAATTGCTATGCTTTTAGTGTATCCGAATCTATATTTAGACTTAGTATTATGTTTTTTTTGGCGGTTTTACTTCTTAGTTCAAAGTTGAATAATGTACATGTCATGTTTTACTCGAGTCACATTACTCATTAA
Predicted protein sequences of Glyma06g39956
>Glyma06g39956.1   sequence type=predicted peptide   gene model=Glyma06g39956   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRTYDVFVCFRVETRNDFNGFLFKALRRKGIDAFKDDKDIRKVAHLCNCIQTSPRRVVPIFYDVDTSHVRNQSGCYEIAFAKYAERLKEDKENTDEMQRWREALTRVASVSGNLLRRQRVMQFSLYFLTDSKLMDFYNCYAFSVSESIFRLSIMFFLAVLLLSSKLNNVHVMFYSSHITH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo