SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g39891

Feature Type:gene_model
Chromosome:Gm06
Start:42877935
stop:42878796
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g39891
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G38110AT Annotation by Michelle Graham. TAIR10: glycerol-3-phosphate acyltransferase 6 | chr2:15952816-15955364 REVERSE LENGTH=501 SoyBaseE_val: 4.00E-142ISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009908GO-bp Annotation by Michelle Graham. GO Biological Process: flower development SoyBaseN/AISS
GO:0010143GO-bp Annotation by Michelle Graham. GO Biological Process: cutin biosynthetic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0016746GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups SoyBaseN/AISS
GO:0016791GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatase activity SoyBaseN/AISS
GO:0090447GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerol-3-phosphate 2-O-acyltransferase activity SoyBaseN/AISS
PTHR15486Panther ANCIENT UBIQUITOUS PROTEIN JGI ISS
PF01553PFAM Acyltransferase JGI ISS
UniRef100_B9SZD1UniRef Annotation by Michelle Graham. Most informative UniRef hit: ER glycerol-phosphate acyltransferase n=1 Tax=Ricinus communis RepID=B9SZD1_RICCO SoyBaseE_val: 1.00E-168ISS
UniRef100_UPI000233A736UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A736 related cluster n=1 Tax=unknown RepID=UPI000233A736 SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g39891
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g39891 not represented in the dataset
Glyma06g39891 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g39891 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g255600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g39891
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g39891
>Glyma06g39891.1   sequence type=CDS   gene model=Glyma06g39891   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTCATGAGGGTAGGTTTGTTCAAAGGCCAACTCCTCTAGCAGCCCTTTTGACCTTTCTATGGTTGCCAATTGGCATCATACTCTCCATCTTAAGGGTCTACCTTAACATCCCTTTGCCTGAAAGAATTGCTTGGTATAACTATAAACTATTAGGAATTAGAGTTATTGTGAAGGGTACCCCTCCACCATCCCCAAAGAAGGGTCAAAGTGGTGTCCTATTTGTTTGTAACCACCGCACAGTTTTAGACCCTGTGGTTACTGCAGTTGCACTTGGAAGAAAAATTAGTTGTGTCACATATAGCATAAGCAAATTCACTAAAATAATTTCACCAATTAAAGTTGTGGCGCTCTCAAGGGAAAGAGAGAAAGATGTTGCCAATATCAAGAGACTACTTGAGGAAGGGGACTTGGTGATTTGCCCTGAAGGCACAACTTGTAGAGAGCCTTTCCTCTTGAGGTTCAGTGCACTATTTGCTGAACTCACTGATAGGAGTGTCCCAATTGCTATTAACACAAAGCAAAGTGTGTTCTACGGAACCACGGTTTGCAGACACAAGTTGTTGGACCCCTACTTTGTGTTCATGAATCCAATGCCAACATATGAGATCACTTTCTTGAACCAGCTTCCTAAGGAGCTCACATGCAGTGGAGGGAAATCAGCTATTGAAGTTGCAAACTACATTCAAAGGGTTCTTGCAGGGACTTTGGGATTTGAGTGCACAAATTTGACTAGGAAGAGAAAATATGCCATGCTTTCAGGGACTTTGCTTTCAATTATTTTCAGCTATATAATTTTCAATTATTATCACAGACACTTGCGCACTTCTATATAA
Predicted protein sequences of Glyma06g39891
>Glyma06g39891.1   sequence type=predicted peptide   gene model=Glyma06g39891   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFHEGRFVQRPTPLAALLTFLWLPIGIILSILRVYLNIPLPERIAWYNYKLLGIRVIVKGTPPPSPKKGQSGVLFVCNHRTVLDPVVTAVALGRKISCVTYSISKFTKIISPIKVVALSREREKDVANIKRLLEEGDLVICPEGTTCREPFLLRFSALFAELTDRSVPIAINTKQSVFYGTTVCRHKLLDPYFVFMNPMPTYEITFLNQLPKELTCSGGKSAIEVANYIQRVLAGTLGFECTNLTRKRKYAMLSGTLLSIIFSYIIFNYYHRHLRTSI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo