SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g38581): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g38581): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g38581

Feature Type:gene_model
Chromosome:Gm06
Start:41545351
stop:41546235
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G17930AT Annotation by Michelle Graham. TAIR10: Phosphatidylinositol 3- and 4-kinase family protein with FAT domain | chr2:7784455-7802230 REVERSE LENGTH=3858 SoyBaseE_val: 8.00E-73ISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0010050GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative phase change SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0016246GO-bp Annotation by Michelle Graham. GO Biological Process: RNA interference SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
GO:0016773GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor SoyBaseN/AISS
PTHR11139Panther ATAXIA TELANGIECTASIA MUTATED (ATM)-RELATED JGI ISS
PTHR11139:SF1Panther ATAXIA-TELANGIECTASIA MUTATED PROTEIN (ATM) JGI ISS
UniRef100_G7JW74UniRef Annotation by Michelle Graham. Best UniRef hit: Transcription-associated protein n=1 Tax=Medicago truncatula RepID=G7JW74_MEDTR SoyBaseE_val: 5.00E-80ISS
UniRef100_G7JW74UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription-associated protein n=1 Tax=Medicago truncatula RepID=G7JW74_MEDTR SoyBaseE_val: 5.00E-80ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g38581 not represented in the dataset

Glyma06g38581 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g249900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g38581.1   sequence type=CDS   gene model=Glyma06g38581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATGTTGATTTTGTAAGGGAGTACAATCAAGATTTTGAATGTGATCTTGATCCAGAAAGCACTGCTACTTTCCCATCCACTTTGTCTCAACTGACTGAGCGGTTGAAACACTGGAAAAATGTTCTTCAAAACAATGTTGAGGATAGCTTTCCAGCAGTATTAAAGTTGGAAAAAGAAAGCAAGGTATTACGGGACTTCCACGTTATTGATGTTGAAGTTCTAGGGCAATATTTCACTGATCAAGAGACTGCTTCTGATTTTTTTTCAAACAATAAAATTGCACCAGATCATACCGTGAAGTTGGATAGGGTTGCTGCTGATATTCCAATTGTGCGGAGGCATGGGAGCAGTTTTCGGCGCTTGACTCTAATTGGGTTTGATGGTTCCCAACGTCATTTTATTGTCCAAACATCTTTGACTCCCAATGCTAGAACTGATGAACGCATACTGCAACTTTTCCCTTACCTTAAATTAACAATCCTAAAAGCTTGA

>Glyma06g38581.1   sequence type=predicted peptide   gene model=Glyma06g38581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHVDFVREYNQDFECDLDPESTATFPSTLSQLTERLKHWKNVLQNNVEDSFPAVLKLEKESKVLRDFHVIDVEVLGQYFTDQETASDFFSNNKIAPDHTVKLDRVAADIPIVRRHGSSFRRLTLIGFDGSQRHFIVQTSLTPNARTDERILQLFPYLKLTILKA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo