Glyma06g38581 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g38581): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g38581): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g38581

Feature Type:	gene_model
Chromosome:	Gm06
Start:	41545351
stop:	41546235
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g38581

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G17930	AT	Annotation by Michelle Graham. TAIR10: Phosphatidylinositol 3- and 4-kinase family protein with FAT domain \| chr2:7784455-7802230 REVERSE LENGTH=3858	SoyBase	E_val: 8.00E-73	ISS
GO:0000226	GO-bp	Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization	SoyBase	N/A	ISS
GO:0000911	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation	SoyBase	N/A	ISS
GO:0006346	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing	SoyBase	N/A	ISS
GO:0009616	GO-bp	Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing	SoyBase	N/A	ISS
GO:0010050	GO-bp	Annotation by Michelle Graham. GO Biological Process: vegetative phase change	SoyBase	N/A	ISS
GO:0010267	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference	SoyBase	N/A	ISS
GO:0016246	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA interference	SoyBase	N/A	ISS
GO:0035196	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
GO:0016773	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor	SoyBase	N/A	ISS
PTHR11139	Panther	ATAXIA TELANGIECTASIA MUTATED (ATM)-RELATED	JGI		ISS
PTHR11139:SF1	Panther	ATAXIA-TELANGIECTASIA MUTATED PROTEIN (ATM)	JGI		ISS
UniRef100_G7JW74	UniRef	Annotation by Michelle Graham. Best UniRef hit: Transcription-associated protein n=1 Tax=Medicago truncatula RepID=G7JW74_MEDTR	SoyBase	E_val: 5.00E-80	ISS
UniRef100_G7JW74	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription-associated protein n=1 Tax=Medicago truncatula RepID=G7JW74_MEDTR	SoyBase	E_val: 5.00E-80	ISS

Expression Patterns of Glyma06g38581

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g38581 not represented in the dataset	Glyma06g38581 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g38581 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g249900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g38581

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g38581

Limit To All Plant Sequences

>Glyma06g38581.1   sequence type=CDS   gene model=Glyma06g38581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATGTTGATTTTGTAAGGGAGTACAATCAAGATTTTGAATGTGATCTTGATCCAGAAAGCACTGCTACTTTCCCATCCACTTTGTCTCAACTGACTGAGCGGTTGAAACACTGGAAAAATGTTCTTCAAAACAATGTTGAGGATAGCTTTCCAGCAGTATTAAAGTTGGAAAAAGAAAGCAAGGTATTACGGGACTTCCACGTTATTGATGTTGAAGTTCTAGGGCAATATTTCACTGATCAAGAGACTGCTTCTGATTTTTTTTCAAACAATAAAATTGCACCAGATCATACCGTGAAGTTGGATAGGGTTGCTGCTGATATTCCAATTGTGCGGAGGCATGGGAGCAGTTTTCGGCGCTTGACTCTAATTGGGTTTGATGGTTCCCAACGTCATTTTATTGTCCAAACATCTTTGACTCCCAATGCTAGAACTGATGAACGCATACTGCAACTTTTCCCTTACCTTAAATTAACAATCCTAAAAGCTTGA

Predicted protein sequences of Glyma06g38581

Limit To All Plant Sequences

>Glyma06g38581.1   sequence type=predicted peptide   gene model=Glyma06g38581   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHVDFVREYNQDFECDLDPESTATFPSTLSQLTERLKHWKNVLQNNVEDSFPAVLKLEKESKVLRDFHVIDVEVLGQYFTDQETASDFFSNNKIAPDHTVKLDRVAADIPIVRRHGSSFRRLTLIGFDGSQRHFIVQTSLTPNARTDERILQLFPYLKLTILKA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain