SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma06g38076

Feature Type:gene_model
Chromosome:Gm06
Start:40854187
stop:40854915
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G34790AT Annotation by Michelle Graham. TAIR10: FAD-binding Berberine family protein | chr2:14673998-14677237 REVERSE LENGTH=532 SoyBaseE_val: 4.00E-80ISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010197GO-bp Annotation by Michelle Graham. GO Biological Process: polar nucleus fusion SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008762GO-mf Annotation by Michelle Graham. GO Molecular Function: UDP-N-acetylmuramate dehydrogenase activity SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016614GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on CH-OH group of donors SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
PTHR11748Panther D-LACTATE DEHYDROGENASE JGI ISS
PTHR11748:SF29Panther SUBFAMILY NOT NAMED JGI ISS
PF01565PFAM FAD binding domain JGI ISS
UniRef100_G7IML7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Reticuline oxidase-like protein n=1 Tax=Medicago truncatula RepID=G7IML7_MEDTR SoyBaseE_val: 3.00E-104ISS
UniRef100_I1MG66UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MG66_SOYBN SoyBaseE_val: 2.00E-130ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g38076 not represented in the dataset

Glyma06g38076 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g246100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g38076.1   sequence type=CDS   gene model=Glyma06g38076   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGTCACCAAGCTCAAACTTAGCAACTTTAATCCTCCTATTATCAGTTTCAATGGCAGCTTCAGCTTCATTTGAAGAAAACTTTGTCCAATGTCTCAGCTTCTATTCAGACAAAGCAGCTCCATTTTATGCATCAATTTACACTCCACAAAATGCATCATTCAACAAGATCCTTGAATCCTCTACACAGAACCTAAGAATTCGTAGCGGTGGCCATGATTATGAAGGACTCTCATATGTTTCTGAAGTTGAGACCCCTTTCATAATTGTTGATTTGTCCAAGCTTCACGCTGTCAACGTTGATATAGAAGACAACACTGCTTGGATTCAAGTCGGTGCCACTATTGGGGAGGTCTATTACAAAATATATGAGAAAAGTTTGGTTCATGGTTTCCCTGCAGGCCTTTGCACAAGTTTAGGTGTTGGAGGGCACATCACGGGAGGTGCATATGGATCCATGATGAGAAAGTATGGCCTTGGAGTTGACAATGTCCTAGATGCAAGAATAGTTGACGCAAATGGCCAAATCCTTGATAGGGAAGCCGTGGGGGAAGATCTCTTTTGGGCTATTAGAAAAGGTGGAGGAGCAAGCTTTGGTATCCTTCTTTGGTGGAAATAA

>Glyma06g38076.1   sequence type=predicted peptide   gene model=Glyma06g38076   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSPSSNLATLILLLSVSMAASASFEENFVQCLSFYSDKAAPFYASIYTPQNASFNKILESSTQNLRIRSGGHDYEGLSYVSEVETPFIIVDLSKLHAVNVDIEDNTAWIQVGATIGEVYYKIYEKSLVHGFPAGLCTSLGVGGHITGGAYGSMMRKYGLGVDNVLDARIVDANGQILDREAVGEDLFWAIRKGGGASFGILLWWK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo