SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g37970

Feature Type:gene_model
Chromosome:Gm06
Start:40710882
stop:40714328
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g37970
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G15360AT Annotation by Michelle Graham. TAIR10: thioredoxin M-type 4 | chr3:5188448-5189457 FORWARD LENGTH=193 SoyBaseE_val: 1.00E-61ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006109GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of carbohydrate metabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006662GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol ether metabolic process SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0043086GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of catalytic activity SoyBaseN/AISS
GO:0045454GO-bp Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0004857GO-mf Annotation by Michelle Graham. GO Molecular Function: enzyme inhibitor activity SoyBaseN/AISS
GO:0008047GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0015035GO-mf Annotation by Michelle Graham. GO Molecular Function: protein disulfide oxidoreductase activity SoyBaseN/AISS
KOG0910 KOG Thioredoxin-like protein JGI ISS
PTHR10438Panther THIOREDOXIN-RELATED JGI ISS
PTHR10438:SF82Panther SUBFAMILY NOT NAMED JGI ISS
PF00085PFAM Thioredoxin JGI ISS
UniRef100_A7LNX7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Thioredoxin n=1 Tax=Limonium bicolor RepID=A7LNX7_9CARY SoyBaseE_val: 1.00E-71ISS
UniRef100_I1KDX9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KDX9_SOYBN SoyBaseE_val: 7.00E-119ISS

Expression Patterns of Glyma06g37970
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g37970 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g245200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g37970
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g37970
>Glyma06g37970.1   sequence type=CDS   gene model=Glyma06g37970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAACACTCTTCGACTCTCTCGCCGTCGTGCGTCTCCCCACCGCCGCCCGCCGGACCTCCGTTATGCTCCCGCACTGCGCTGGCCTCAGGCTCAGACCCGCCGCCGCTTCGCGCCTAGTTGCGTCCCCCGCTCGCAGGATCGCTTCTCGCGCAGCGCGCGTCGCCTGCGAGGCTCAGGACACCGCCGTGGAAGTGGCTCCTATTACTGATGCAAACTGGCAATCCCTTGTCCTTGAATCCGAATCTGCTGTTTTGGTTGAATTCTGGGCGCCATGGTGTGGTCCCTGCCGAATGATTCACCCTATAATTGATGAACTTGCAAAGCAATATGCTGGGAAGCTCAAGTGTTACAAACTCAACACTGATGAGAGCCCTTCAACCGCTACTCGGTATGGAATTCGAAGCATCCCAACTGTTATGATCTTCAAGAGTGGTGAGAAGAAAGATACAGTTATTGGTGCTGTGCCCAAGTCAACATTGACCACGAGCATAGAAAAATTCGTATGA
Predicted protein sequences of Glyma06g37970
>Glyma06g37970.1   sequence type=predicted peptide   gene model=Glyma06g37970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATLFDSLAVVRLPTAARRTSVMLPHCAGLRLRPAAASRLVASPARRIASRAARVACEAQDTAVEVAPITDANWQSLVLESESAVLVEFWAPWCGPCRMIHPIIDELAKQYAGKLKCYKLNTDESPSTATRYGIRSIPTVMIFKSGEKKDTVIGAVPKSTLTTSIEKFV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo