SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g34890

Feature Type:gene_model
Chromosome:Gm06
Start:36537351
stop:36539103
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g34890
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G54080AT Annotation by Michelle Graham. TAIR10: homogentisate 1,2-dioxygenase | chr5:21945920-21948070 FORWARD LENGTH=461 SoyBaseE_val: 2.00E-147ISS
GO:0006559GO-bp Annotation by Michelle Graham. GO Biological Process: L-phenylalanine catabolic process SoyBaseN/AISS
GO:0006570GO-bp Annotation by Michelle Graham. GO Biological Process: tyrosine metabolic process SoyBaseN/AISS
GO:0006572GO-bp Annotation by Michelle Graham. GO Biological Process: tyrosine catabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0004411GO-mf Annotation by Michelle Graham. GO Molecular Function: homogentisate 1,2-dioxygenase activity SoyBaseN/AISS
PTHR11056Panther HOMOGENTISATE 1,2-DIOXYGENASE JGI ISS
PF04209PFAM homogentisate 1,2-dioxygenase JGI ISS
UniRef100_I1KDN8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KDN8_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q5VRH4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Homogentisate 1,2-dioxygenase n=3 Tax=Oryza RepID=HGD_ORYSJ SoyBaseE_val: 2.00E-150ISS

Expression Patterns of Glyma06g34890
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g34890 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g233800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g34890
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g34890
>Glyma06g34890.1   sequence type=CDS   gene model=Glyma06g34890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAAATATTATATCACTTATAGGTACAATGCCAACAAATCAATGGACAATTGTGCCTTTTGCAATGCTGATGGTGACTTCTTGATAGTTCCCCAACAAGGAAGACTCCTTATCACTACTGAATGTGGAAGATTGAAAGTTTCTCCGGGTGAAATTGCTATAATACCTCACGGTTTTCGTTTTTCTGTGAATCTGCCTGATGGTCCATCCCGCGGTTATGTTGCTGAAATTTTTGGTACTCATTTTCAACTTCCTGATCTGGGACCAATAGGTGCTAATGGTCTTGCTTCCCCAAGGGATTTCCTTGTTCCTACTGCTTGGTTTGAAGATAAATCTTATCCTGGGTACACCATAGTGCAGAAGTTTGGTGGTGAACTCTTTGATGCAGTACAAGATTTCTCTCCCTTCAATGTTGTTGCTTGGCATGGTAATTATTATGATTTAAGCAAATTCTGCCCTTATAATACAGTTCTGTTTGATCATAGTGACCCATCTATCAATACTGTGTTGACCGCACCAACTGATAAACCTGGAGTGGCATTGCTTGATTTTGTCATTTTCCCACCCAGATGGCTGGTTGCTGAGCATACTTTCCTTCCTCCATATTATCATCGCAATTGCATGAGTGAATTTATGGGCCTTATTCATGGTGGCTATGAGGCCAACGCTGATGGATTTCTTCCCGGTGGTGCAAGTCTCCATAATTGTATGACTCCCCATGGTCCTGATACAAAGTCATATGAG
Predicted protein sequences of Glyma06g34890
>Glyma06g34890.1   sequence type=predicted peptide   gene model=Glyma06g34890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKYYITYRYNANKSMDNCAFCNADGDFLIVPQQGRLLITTECGRLKVSPGEIAIIPHGFRFSVNLPDGPSRGYVAEIFGTHFQLPDLGPIGANGLASPRDFLVPTAWFEDKSYPGYTIVQKFGGELFDAVQDFSPFNVVAWHGNYYDLSKFCPYNTVLFDHSDPSINTVLTAPTDKPGVALLDFVIFPPRWLVAEHTFLPPYYHRNCMSEFMGLIHGGYEANADGFLPGGASLHNCMTPHGPDTKSYE






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo