SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g32850

Feature Type:gene_model
Chromosome:Gm06
Start:33811114
stop:33822163
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g32850
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G78770AT Annotation by Michelle Graham. TAIR10: anaphase promoting complex 6 | chr1:29617421-29621273 FORWARD LENGTH=543 SoyBaseE_val: 0ISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006261GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication SoyBaseN/AISS
GO:0006270GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication initiation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007049GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0007276GO-bp Annotation by Michelle Graham. GO Biological Process: gamete generation SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010087GO-bp Annotation by Michelle Graham. GO Biological Process: phloem or xylem histogenesis SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0016458GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0032875GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA endoreduplication SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051302GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell division SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG1173 KOG Anaphase-promoting complex (APC), Cdc16 subunit JGI ISS
PTHR12558Panther ANAPHASE PROMOTING COMPLEX SUBUNIT JGI ISS
PTHR12558:SF9Panther CELL DIVISION CYCLE 16 JGI ISS
PF00515PFAM Tetratricopeptide repeat JGI ISS
UniRef100_D0VFU6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cell division cycle 16 n=1 Tax=Medicago truncatula RepID=D0VFU6_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KDK4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KDK4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g32850
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g32850 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g228700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g32850
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g32850
>Glyma06g32850.1   sequence type=CDS   gene model=Glyma06g32850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGGAGGAAGAGATGGAGAAGCTTCGAGGAGTGGTGCGGGACTGCGTGAGCAAGCACCTCTACTCCTCCGCCATCTTCTTCGCCGACAAAGTGGCAGCCTTCACCGCCGACCCCGCAGACATCTACATGCAGGCCCAGGCCCTCTTCCTCGGCCGCCACTACCGCCGCGCCTTCCACCTCCTCAACGCATCCAAAATCGTCCTCACCGACCTCCGATTCCGCTACCTCGCCGCCAAGTGCCTCGAGGAACTGAAGGAGTGGGATCAGTGCCTGTCGATGCTGGGTGAGGCTAAAGTGGACGACGATGGAAATGTTTATGATATGAAGGACTCTAATGTCATGTACTTGGATAAAGATTGTGAAGATCGTGAAATCAATATATCCTCCGCAATATGCTTCTTAAGAGGCAAAGCATATGAAGCTTTAGAAAACCGTGCCCAGGCCAGAATGTGGTATAAAGCTGCTATAAAAGCGGATCCTTTATGCTATGAGGCTTTGGAATGCCTTATTGAGAATCACATGCTTACATGTGAGGAAGAAGCAAATTTGATCTCATCATTGCAATTTGGTAGTGAGGATGGATGGCTCTCTTCATTTTATTCTTGTTTGATAAAGAAGTATGACAAAGAAAATATTGTAGTAGCCAAGTTCAGAGATCTTGAGAATGAAAGCTGTAAAAGTGACCAATCAGATTCTTCTTTTTTGCGGACACTGAAATCCAATACTGATCTATTGGCCTGCAAAGCTGAATACTACCATCAGTGCGGTGAATATCAGAAATGTTTTGAGTTAACAAATGATTTGCTTGAGAAGGATCTTTTCCATCTAAAGACTACGCTAGTACATCTGGCAGCTGCTGTGGAGCTTGGGCATTCAAATGAACTCTATCTGATGTCATGCAATTTGGTGAAGGATTATCCTCAGATGGCTTTATCATGGTTTGCTGTTGGTTGCTACTACTATTGTATCAAGAAGTATGATCAATCCCGCCGTTATTTTAGCAAGGCAACTAGTCTAGATGGAACATTTCCCCCTGCATGGATAGGCTATGGGAATGCTTATGCTGCTCAAGAAGAGGGAGACCAGGCTATGTCTGCTTACCGCACTGCAGCTAGATTGTTTCCTGGGTGCCATTTAGCAACTCTTTACATTGGAATGGAATGCATGCGGACCCACAGTTATAAGCTTGCTGAGCAGTTTTTTACGCAGGCCAAGTCAATTTGCTCCTCAGATCCACTTGTGTATAATGAACTTGGAGTTGTTGCCTACCATATGGAAGAGTATAAGAAAGCAGTGTGGTGGTTTGAGAAAACATTAGCCTTGGTACCAACCACTTTATCTGAAATTTGGGAATCGACTGTAGTCAATCTTGCACATGCATACAGAAAGCTGAAGATGTACCGAGAAGCAATTTCATATTATGAGAAAGCACTTGCATTATCAACAAGAAGTGTGAGCACTTATGCCGGTCTTGCATATACTTACCACCTACAGGATGATTTCACCACAGCAATTGCATATTATCACAAAGCCTTGTGGCTGAAACCAGATGATCAGTTCTGCACTGAAATGTTAAGTTGGGCTCTAATAGATGAAAGTCGAAGAGGCGTTGACCCCAGTCTTGAATTCCGTTGA
Predicted protein sequences of Glyma06g32850
>Glyma06g32850.1   sequence type=predicted peptide   gene model=Glyma06g32850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MREEEMEKLRGVVRDCVSKHLYSSAIFFADKVAAFTADPADIYMQAQALFLGRHYRRAFHLLNASKIVLTDLRFRYLAAKCLEELKEWDQCLSMLGEAKVDDDGNVYDMKDSNVMYLDKDCEDREINISSAICFLRGKAYEALENRAQARMWYKAAIKADPLCYEALECLIENHMLTCEEEANLISSLQFGSEDGWLSSFYSCLIKKYDKENIVVAKFRDLENESCKSDQSDSSFLRTLKSNTDLLACKAEYYHQCGEYQKCFELTNDLLEKDLFHLKTTLVHLAAAVELGHSNELYLMSCNLVKDYPQMALSWFAVGCYYYCIKKYDQSRRYFSKATSLDGTFPPAWIGYGNAYAAQEEGDQAMSAYRTAARLFPGCHLATLYIGMECMRTHSYKLAEQFFTQAKSICSSDPLVYNELGVVAYHMEEYKKAVWWFEKTLALVPTTLSEIWESTVVNLAHAYRKLKMYREAISYYEKALALSTRSVSTYAGLAYTYHLQDDFTTAIAYYHKALWLKPDDQFCTEMLSWALIDESRRGVDPSLEFR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo