Glyma06g29663 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g29663): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g29663): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g29663

Feature Type:	gene_model
Chromosome:	Gm06
Start:	28213715
stop:	28217872
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g29663

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G16970	AT	Annotation by Michelle Graham. TAIR10: alkenal reductase \| chr5:5576291-5578001 REVERSE LENGTH=345	SoyBase	E_val: 1.00E-115	ISS
GO:0006865	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid transport	SoyBase	N/A	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0010583	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone	SoyBase	N/A	ISS
GO:0015824	GO-bp	Annotation by Michelle Graham. GO Biological Process: proline transport	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0016747	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups	SoyBase	N/A	ISS
GO:0032440	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 2-alkenal reductase [NAD(P)] activity	SoyBase	N/A	ISS
KOG1196	KOG	Predicted NAD-dependent oxidoreductase	JGI		ISS
PTHR11695	Panther	ALCOHOL DEHYDROGENASE RELATED	JGI		ISS
PTHR11695:SF5	Panther	BENZYLALCOHOL DEHYDROGENASE	JGI		ISS
PF00107	PFAM	Zinc-binding dehydrogenase	JGI		ISS
UniRef100_B9SER7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Alcohol dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9SER7_RICCO	SoyBase	E_val: 2.00E-176	ISS
UniRef100_UPI0002339A4B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002339A4B related cluster n=1 Tax=unknown RepID=UPI0002339A4B	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g29663

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g29663 not represented in the dataset	Glyma06g29663 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g29663 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g222500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g29663

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g29663

Limit To All Plant Sequences

>Glyma06g29663.1   sequence type=CDS   gene model=Glyma06g29663   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGTGACGAATAAATACATAGTAATAAAGCATCACGTTGAAGATGCACCTAAACAGTCCAATTTTGAGCTCAAAACTAAGGCTTTTGCTCTGTCAGTTGAGTCAGGATCTGATGATATCATTGTGAAGAATCTCTACATTTCTATTGATCCCTATCAGATTAACCGCATGAAGAGTTATAGCTCTTCCCAGGGCACTATAAACTTTGCAGTGCCCATAACCCCAGGCGAGGCTATTGATGGTGCTGTTATTGGAAAAGTTGTGGCTTCTGGGAATGCTAAGTTTCAAAAAGATGATTTGGTGATGGGAGTATTCACTTGGGCAGAGTACAGTTTGGTCAAAGAAGGGAACATAATAAAAAAATTAGAGTCCTCTGAATTTCCACTCTCTTATCATCTTGGAGTTCTGGGATTCAATGGACTGTCAGCTTATGCGGGGTTTTTTGAATTGTGTAAACCCCTAAAGGGTGAAAAGGTCTTTGTCTCAACAGCTTCTGGAGCAGTTGGAAACTTGGTAGGGCAATATGCAAAGCTTTTAGGTTGTTATGTTGTTGGTTGTGCAGGGAGCCAGAAAAAGGTTGCATTGCTTAAAGAAAAGCTAGGATTTGATGATGCATTCAACTACAAGGAAGAAACAGATCTAAACTCCACTCTTAAAAGGTATTTTCCTGATGGAATTGATGTATATTTTGACAATGTTGGGGGTGAGATGCTGGAAGCAGCGGTTGCTAACATGAAAGCATTTGGAAGAGTGGCTATTTGTGGGGTAATATCTGAGTATACTAGTGCTGGAAAGAGAGCTTCACCAAACATGTTGGATGTTGTGTACAAGAGAATCAACATCAGAGGATTTTTAGCTGCTGATTTTCTGAATGTTTTTGAAGATTTTTCCACAAAAACTTCGGATTACATACGTACAGGGAAGTTGAAGGTGATTGAAGACTTGTCATTGGGGGTGGAGAGCATCCCTTCTGCTTTTGTTGGACTCTTCAAAGGGGATAACATTGGAAAGAAAATTATAAGTTTAACAGAAGAGTGA

Predicted protein sequences of Glyma06g29663

Limit To All Plant Sequences

>Glyma06g29663.1   sequence type=predicted peptide   gene model=Glyma06g29663   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVTNKYIVIKHHVEDAPKQSNFELKTKAFALSVESGSDDIIVKNLYISIDPYQINRMKSYSSSQGTINFAVPITPGEAIDGAVIGKVVASGNAKFQKDDLVMGVFTWAEYSLVKEGNIIKKLESSEFPLSYHLGVLGFNGLSAYAGFFELCKPLKGEKVFVSTASGAVGNLVGQYAKLLGCYVVGCAGSQKKVALLKEKLGFDDAFNYKEETDLNSTLKRYFPDGIDVYFDNVGGEMLEAAVANMKAFGRVAICGVISEYTSAGKRASPNMLDVVYKRINIRGFLAADFLNVFEDFSTKTSDYIRTGKLKVIEDLSLGVESIPSAFVGLFKGDNIGKKIISLTEE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain