Glyma06g28650 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g28650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g28650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g28650

Feature Type:	gene_model
Chromosome:	Gm06
Start:	27180704
stop:	27183184
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g28650

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G20230	AT	Annotation by Michelle Graham. TAIR10: blue-copper-binding protein \| chr5:6826626-6827408 FORWARD LENGTH=196	SoyBase	E_val: 9.00E-23	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009620	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fungus	SoyBase	N/A	ISS
GO:0009646	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to absence of light	SoyBase	N/A	ISS
GO:0009695	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0015690	GO-bp	Annotation by Michelle Graham. GO Biological Process: aluminum cation transport	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0031225	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane	SoyBase	N/A	ISS
GO:0046658	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0009055	GO-mf	Annotation by Michelle Graham. GO Molecular Function: electron carrier activity	SoyBase	N/A	ISS
PF02298	PFAM	Plastocyanin-like domain	JGI		ISS
UniRef100_F4YAW4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Copper binding protein 5 n=1 Tax=Gossypium hirsutum RepID=F4YAW4_GOSHI	SoyBase	E_val: 3.00E-38	ISS
UniRef100_I1KDE7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KDE7_SOYBN	SoyBase	E_val: 3.00E-141	ISS

Expression Patterns of Glyma06g28650

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g28650 not represented in the dataset	Glyma06g28650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g28650 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g220700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g28650

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g28650

Limit To All Plant Sequences

>Glyma06g28650.1   sequence type=CDS   gene model=Glyma06g28650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTCAGTTACATAATATTATGGTGATTCTTATAGTAATTGCAGTTGCTGCAACAATGCTAAAGAGCACCAAAGCCGCAGAATACACTGTAGGGGACAACACTGGTTGGACAAGTGCTCCTCCTGGTGGCGCTTCATTCTATTCCGACTGGGCTTCCAATATAACATTCAGAGAAGGCGACATACTAGTCTTCACATTCACCGCAAGCCACACCGTGGCCGAACTTACCGACAGGGCAAGCTTTGATGGTTGCAGCGTGAATCAAAACCAGGGAGTCATTACCACATCACCAGCAAGAATCACACTCAATCGTACCGGGGACTTCTATTTTGCATGCACCATCCAAGGCCATTGCAACAGTGGCCAAAAGCTGAGCATTGCCACCATCACAAGCACTTCTTCACCTCCAACTCAAGGTCCTTCTCCTCCTTCTGGAACCACTCCTACCCCACCTTCTTCCGGCGACGAAACACCGCCTCCCCAATCTCCCCCGACCGAGCCTGGTTCAACTACACCTCCTCCATCGCGAGGCGAGGCTACCTCCCTTGTTGCAACTTTCTCTATTCTTCTCATCACCCTTTTAATCAACTCATTGTTGTTTTAA

Predicted protein sequences of Glyma06g28650

Limit To All Plant Sequences

>Glyma06g28650.1   sequence type=predicted peptide   gene model=Glyma06g28650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGQLHNIMVILIVIAVAATMLKSTKAAEYTVGDNTGWTSAPPGGASFYSDWASNITFREGDILVFTFTASHTVAELTDRASFDGCSVNQNQGVITTSPARITLNRTGDFYFACTIQGHCNSGQKLSIATITSTSSPPTQGPSPPSGTTPTPPSSGDETPPPQSPPTEPGSTTPPPSRGEATSLVATFSILLITLLINSLLF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain