Glyma06g24170 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g24170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g24170): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g24170

Feature Type:	gene_model
Chromosome:	Gm06
Start:	21616560
stop:	21618619
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g24170

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G27530	AT	Annotation by Michelle Graham. TAIR10: golgin candidate 6 \| chr3:10193778-10199659 REVERSE LENGTH=914	SoyBase	E_val: 1.00E-87	ISS
GO:0000956	GO-bp	Annotation by Michelle Graham. GO Biological Process: nuclear-transcribed mRNA catabolic process	SoyBase	N/A	ISS
GO:0006486	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein glycosylation	SoyBase	N/A	ISS
GO:0006886	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular protein transport	SoyBase	N/A	ISS
GO:0007033	GO-bp	Annotation by Michelle Graham. GO Biological Process: vacuole organization	SoyBase	N/A	ISS
GO:0009639	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to red or far red light	SoyBase	N/A	ISS
GO:0009791	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-embryonic development	SoyBase	N/A	ISS
GO:0032527	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein exit from endoplasmic reticulum	SoyBase	N/A	ISS
GO:0048193	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport	SoyBase	N/A	ISS
GO:0048280	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle fusion with Golgi apparatus	SoyBase	N/A	ISS
GO:0000139	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi membrane	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005795	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi stack	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0008565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein transporter activity	SoyBase	N/A	ISS
PTHR10013	Panther	VESICLE DOCKING PROTEIN P115	JGI		ISS
UniRef100_B0F9L4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Golgin candidate 6 n=1 Tax=Arabidopsis thaliana RepID=GOGC6_ARATH	SoyBase	E_val: 5.00E-85	ISS
UniRef100_I1N5K6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N5K6_SOYBN	SoyBase	E_val: 1.00E-110	ISS

Expression Patterns of Glyma06g24170

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g24170 not represented in the dataset	Glyma06g24170 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g24170 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma06g24170

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g24170

Limit To All Plant Sequences

>Glyma06g24170.1   sequence type=CDS   gene model=Glyma06g24170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GTAATAAGGAATAAGGCATTATTGCTTCTTACTCATCTGACTCGTGAAGCTAAGGAGATTCAAAAAATTGTCGTCTTTGAAGGTGCATTTGAGAAGATTTTCAGTATCATAAGAGAGGAGGGAAATTCAGATGGTGGTGTTGTGGACTGCCTTGAATTGTTGAACAATTTGCTTCGTAGCAATGCATCCAATCAGGTACTACTAAGAGAGACTGTAGGACTTGACTCATTGATATTGATTTTGAAGCTGAGAGGAAGTAGTTTCACTTTTAATCAACAAAAGTTGACAATCAATCTACTTATTGCATTAGAAACCATTAAATTATTACTAAGGGAGGTTCTGAGTCTGAAAAAGGTATTGGACCATTTGTTAATATTAGGTGTTGAAAGCCAATGCGTACCTGTTCTCGTTCGCTGTGCGGCAATGCGATGCATTGGTGATTTGATTGCTGGAGATTCAAAGAATCGTGATCTTCTTGCTAGCAAAGTTCTTGGAGAGGAACCACACATTGAACCTACTTTGAACTCTATACTTAGAATCCTTTTGAGAACTTCAAGCATGCAAGAGTTCATTGCTATTGATTATATTTTCAAAAGCTTT

Predicted protein sequences of Glyma06g24170

Limit To All Plant Sequences

>Glyma06g24170.1   sequence type=predicted peptide   gene model=Glyma06g24170   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
VIRNKALLLLTHLTREAKEIQKIVVFEGAFEKIFSIIREEGNSDGGVVDCLELLNNLLRSNASNQVLLRETVGLDSLILILKLRGSSFTFNQQKLTINLLIALETIKLLLREVLSLKKVLDHLLILGVESQCVPVLVRCAAMRCIGDLIAGDSKNRDLLASKVLGEEPHIEPTLNSILRILLRTSSMQEFIAIDYIFKSF

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain