Glyma06g21665 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g21665): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g21665): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g21665

Feature Type:	gene_model
Chromosome:	Gm06
Start:	18206299
stop:	18212743
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g21665

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G15920	AT	Annotation by Michelle Graham. TAIR10: Nodulin MtN3 family protein \| chr4:9030742-9033343 REVERSE LENGTH=241	SoyBase	E_val: 2.00E-38	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009750	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0005887	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0051119	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar transmembrane transporter activity	SoyBase	N/A	ISS
PTHR10791	Panther	STROMAL CELL PROTEIN/NODULIN MTN3-RELATED	JGI		ISS
PF00722	PFAM	Glycosyl hydrolases family 16	JGI		ISS
PF03083	PFAM	MtN3/saliva family	JGI		ISS
UniRef100_Q84WN3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Bidirectional sugar transporter SWEET17 n=1 Tax=Arabidopsis thaliana RepID=SWT17_ARATH	SoyBase	E_val: 1.00E-35	ISS
UniRef100_UPI0002338D52	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002338D52 related cluster n=1 Tax=unknown RepID=UPI0002338D52	SoyBase	E_val: 2.00E-92	ISS

Expression Patterns of Glyma06g21665

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g21665 not represented in the dataset	Glyma06g21665 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g21665 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g200800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g21665

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma06g21665

Limit To All Plant Sequences

>Glyma06g21665.2   sequence type=transcript   gene model=Glyma06g21665   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGAAAATAACCTTATTGCTTCTTGGTCTGCAAAATATCATGGCAGATGCAAGTTTCTTTGTTGGAGTCATAGGCAGCATCATCTCAATTCTCATGTTTCTTTCTCCTGTACCTACGTTTTGGAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGTTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGTCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGGTAGAACTGTCATTTTGGCTGTGATTTTGGATGTGGCAATTTCGACAGTAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCGTGGTACTCAATTAGCATTGCAAAGAGAAGCTCATGGTGGTGGTGTTGGTGTTATGGGAGCATGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTGCCATGGTTCTGCACATTCTTCCATGTTTTAGTTGGATATATTGGTTATGCACGGTTTCTTTCACGTTAGAGGATGGCTGATGGAATCCATA

Coding sequences of Glyma06g21665

Limit To All Plant Sequences

>Glyma06g21665.1   sequence type=CDS   gene model=Glyma06g21665   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCTATCTCTGGTTCGACCCCACCAGAAACTTCCACACTTATTCTATCATTTGGAAGCACCAGCACATCATACCTACGTTTTGGAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGTTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGTCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGGTAGAACTGTCATTTTGGCTGTGATTTTGGATGTGGCAATTTCGACAGTAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCGTGGTACTCAATTAGCATTGCAAAGAGAAGCTCATGGTGGTGGTGTTGGTGTTATGGGAGCATGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTGCCATGGTTCTGCACATTCTTCCATGTTTTAGTTGGATATATTGGTTATGCACGGTTTCTTTCACGTTAGAGGATGGCTGA

>Glyma06g21665.2   sequence type=CDS   gene model=Glyma06g21665   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGATGCAAGTTTCTTTGTTGGAGTCATAGGCAGCATCATCTCAATTCTCATGTTTCTTTCTCCTGTACCTACGTTTTGGAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGTTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGTCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGGTAGAACTGTCATTTTGGCTGTGATTTTGGATGTGGCAATTTCGACAGTAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCGTGGTACTCAATTAGCATTGCAAAGAGAAGCTCATGGTGGTGGTGTTGGTGTTATGGGAGCATGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTGCCATGGTTCTGCACATTCTTCCATGTTTTAGTTGGATATATTGGTTATGCACGGTTTCTTTCACGTTAGAGGATGGCTGA

Predicted protein sequences of Glyma06g21665

Limit To All Plant Sequences

>Glyma06g21665.1   sequence type=predicted peptide   gene model=Glyma06g21665   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFYLWFDPTRNFHTYSIIWKHQHIIPTFWKIKKHGSTEDFSSLPYICTLLNCSLWTYYGIIKAREYLVATVDGFGIVVETIYVILFLIYAPKGIRGRTVILAVILDVAISTVAVVTTQLALQREARGTQLALQREAHGGGVGVMGACLNIVMYFSPLSAMVLHILPCFSWIYWLCTVSFTLEDG*

>Glyma06g21665.2   sequence type=predicted peptide   gene model=Glyma06g21665   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADASFFVGVIGSIISILMFLSPVPTFWKIKKHGSTEDFSSLPYICTLLNCSLWTYYGIIKAREYLVATVDGFGIVVETIYVILFLIYAPKGIRGRTVILAVILDVAISTVAVVTTQLALQREARGTQLALQREAHGGGVGVMGACLNIVMYFSPLSAMVLHILPCFSWIYWLCTVSFTLEDG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain