SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g21572): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g21572): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g21572

Feature Type:gene_model
Chromosome:Gm06
Start:18132580
stop:18134116
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g21572
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G15920AT Annotation by Michelle Graham. TAIR10: Nodulin MtN3 family protein | chr4:9030742-9033343 REVERSE LENGTH=241 SoyBaseE_val: 8.00E-47ISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005887GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0051119GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar transmembrane transporter activity SoyBaseN/AISS
PTHR10791Panther STROMAL CELL PROTEIN/NODULIN MTN3-RELATED JGI ISS
PF03083PFAM MtN3/saliva family JGI ISS
UniRef100_Q84WN3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Bidirectional sugar transporter SWEET17 n=1 Tax=Arabidopsis thaliana RepID=SWT17_ARATH SoyBaseE_val: 5.00E-44ISS
UniRef100_UPI0002338D50UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338D50 related cluster n=1 Tax=unknown RepID=UPI0002338D50 SoyBaseE_val: 7.00E-86ISS

Expression Patterns of Glyma06g21572
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g21572 not represented in the dataset
Glyma06g21572 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g21572 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma06g21572
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g21572
>Glyma06g21572.1   sequence type=CDS   gene model=Glyma06g21572   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGATGCAAGTTTCTTTGTTGGAGTCATAGGCAACATCATCTCAATTCTCATGTTTCTTTCTCCTAAAATAAAGAAGCACGGATCTACGGAAGATTTCTCAAGCCTTCCTTACATTTGCACATTGCTTAATTGTTCCTTATGGACTTACTATGGAATCATAAAGGCTAGAGAGTACCTCGTGGCTACTGCCGATGGCTTTGGCATTGTGGTGGAGACAATCTATGTTATTCTATTTCTCATATATGCTCCAAAAGGGATAAGGGTGTGTAGTAGAACTGTCATTTTGGTTGTGATTTTGGATGTGGCAATTTCGACAATAGCAGTAGTTACTACTCAATTAGCATTGCAAAGAGAAGCTCGTGGTGGTGTTGTTGGTGTTATGGGAGCAGGCTTAAACATTGTTATGTATTTCTCACCTCTCTCTTGCCATGGTAAGTTTCACTAA
Predicted protein sequences of Glyma06g21572
>Glyma06g21572.1   sequence type=predicted peptide   gene model=Glyma06g21572   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADASFFVGVIGNIISILMFLSPKIKKHGSTEDFSSLPYICTLLNCSLWTYYGIIKAREYLVATADGFGIVVETIYVILFLIYAPKGIRVCSRTVILVVILDVAISTIAVVTTQLALQREARGGVVGVMGAGLNIVMYFSPLSCHGKFH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo