Report for Sequence Feature Glyma06g20310
Feature Type: gene_model
Chromosome: Gm06
Start: 16724641
stop: 16728094
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g20310
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G02760 AT
Annotation by Michelle Graham. TAIR10: ubiquiting-conjugating enzyme 2 | chr2:774271-775149 FORWARD LENGTH=152
SoyBase E_val: 1.00E-79 ISS
GO:0006511 GO-bp
Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process
SoyBase N/A ISS
GO:0009650 GO-bp
Annotation by Michelle Graham. GO Biological Process: UV protection
SoyBase N/A ISS
GO:0010228 GO-bp
Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem
SoyBase N/A ISS
GO:0033523 GO-bp
Annotation by Michelle Graham. GO Biological Process: histone H2B ubiquitination
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0004842 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity
SoyBase N/A ISS
GO:0016881 GO-mf
Annotation by Michelle Graham. GO Molecular Function: acid-amino acid ligase activity
SoyBase N/A ISS
KOG0419
KOG
Ubiquitin-protein ligase
JGI ISS
PTHR24067 Panther
UBIQUITIN-CONJUGATING ENZYME E2
JGI ISS
PF00179 PFAM
Ubiquitin-conjugating enzyme
JGI ISS
UniRef100_I1KCQ0 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KCQ0_SOYBN
SoyBase E_val: 4.00E-81 ISS
UniRef100_Q677E9 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin-conjugating enzyme (Fragment) n=1 Tax=Hyacinthus orientalis RepID=Q677E9_HYAOR
SoyBase E_val: 7.00E-79 ISS
Expression Patterns of Glyma06g20310
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma06g20310
Paralog Evidence Comments
Glyma04g34170 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g20310 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g190900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g20310
Coding sequences of Glyma06g20310
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g20310.1 sequence type=CDS gene model=Glyma06g20310 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCTGCTGATTTTTGGTCCTGATGATACTCCATGGGATGGAGGCACGTTCAAGTTGACACTCCAATTTACTGAGGACTATCCAAATAAACCACCGACTGTACGATTTGTGTCTCGCATGTTTCATCCAAATATTTATGCTGATGGAAGTATTTGTTTGGATATATTACAAAATCAGTGGAGTCCTATTTATGATGTGGCTGCTATACTCACATCTATCCAGTCATTGCTTTGTGATCCCAACCCAAATTCTCCTGCAAACTCTGAAGCAGCTCGAATGTTTAGTGAGAACAAGCGTGAGTACAATCGAAGAGTGAGGGAAATTGTGGAGCAGAGTTGGACAGCAGATTAA
Predicted protein sequences of Glyma06g20310
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g20310.1 sequence type=predicted peptide gene model=Glyma06g20310 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MLLIFGPDDTPWDGGTFKLTLQFTEDYPNKPPTVRFVSRMFHPNIYADGSICLDILQNQWSPIYDVAAILTSIQSLLCDPNPNSPANSEAARMFSENKREYNRRVREIVEQSWTAD*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
