|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G23100 | AT | Annotation by Michelle Graham. TAIR10: homolog of human DNA ligase iv-binding protein XRCC4 | chr3:8220721-8221991 FORWARD LENGTH=264 | SoyBase | E_val: 2.00E-11 | ISS |
| GO:0006302 | GO-bp | Annotation by Michelle Graham. GO Biological Process: double-strand break repair | SoyBase | N/A | ISS |
| GO:0006310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA recombination | SoyBase | N/A | ISS |
| GO:0008152 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metabolic process | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0003677 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: DNA binding | SoyBase | N/A | ISS |
| GO:0003824 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: catalytic activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
| GO:0008022 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein C-terminus binding | SoyBase | N/A | ISS |
| UniRef100_G7I3Z1 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: DNA repair protein XRCC4 n=1 Tax=Medicago truncatula RepID=G7I3Z1_MEDTR | SoyBase | E_val: 3.00E-28 | ISS |
| UniRef100_I1LC95 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LC95_SOYBN | SoyBase | E_val: 6.00E-42 | ISS |
|
Glyma06g20116 not represented in the dataset |
Glyma06g20116 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.06g189200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma06g20116.1 sequence type=CDS gene model=Glyma06g20116 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTTCATTTATATGCATGTACATGACAAAGTTGTCACAGAAAATGAATTGTTTGAGAAGATGAAAGTGGAAGCTGAGAAGTGCTTAACCCAGACTGAAAGAATTGCCAATGAGAGGCTAGAATTTGAATCTGAAATCTATGCAAAGAAAAGAGTGAAGATTAATGTGAGTGCAATTTTGAGTGGAAACCAAGATGGCCAATTTTTCAAGTCACTACGGAATGTTGGTGTCTCTCTTGCTTACGTGGATCCAAATCCAAGCCAAGAGGAAGACACAGACAAAACTGAGAGTTTTGATGAAGAAAATGATTTTGAAAGAAGTGATGAAGATCCTCAAAAGGATATTACTAGTTCTTCAAAGGAAGTTATGGCAAATAAGCCTTCTCATTCAAAAAGAACTAGACACAAATGA
>Glyma06g20116.1 sequence type=predicted peptide gene model=Glyma06g20116 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MFIYMHVHDKVVTENELFEKMKVEAEKCLTQTERIANERLEFESEIYAKKRVKINVSAILSGNQDGQFFKSLRNVGVSLAYVDPNPSQEEDTDKTESFDEENDFERSDEDPQKDITSSSKEVMANKPSHSKRTRHK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||