SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g19890

Feature Type:gene_model
Chromosome:Gm06
Start:16237282
stop:16241009
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g19890
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48090AT Annotation by Michelle Graham. TAIR10: alpha/beta-Hydrolases superfamily protein | chr3:17755553-17757692 REVERSE LENGTH=623 SoyBaseE_val: 4.00E-138ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0000304GO-bp Annotation by Michelle Graham. GO Biological Process: response to singlet oxygen SoyBaseN/AISS
GO:0001666GO-bp Annotation by Michelle Graham. GO Biological Process: response to hypoxia SoyBaseN/AISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0010618GO-bp Annotation by Michelle Graham. GO Biological Process: aerenchyma formation SoyBaseN/AISS
GO:0010942GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell death SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045088GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004806GO-mf Annotation by Michelle Graham. GO Molecular Function: triglyceride lipase activity SoyBaseN/AISS
GO:0004871GO-mf Annotation by Michelle Graham. GO Molecular Function: signal transducer activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016298GO-mf Annotation by Michelle Graham. GO Molecular Function: lipase activity SoyBaseN/AISS
PF01764PFAM Lipase (class 3) JGI ISS
UniRef100_D6BLY3UniRef Annotation by Michelle Graham. Most informative UniRef hit: EDS1 n=1 Tax=Glycine max RepID=D6BLY3_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1KCL6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KCL6_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma06g19890
LocusGene SymbolProtein Name
EDS1-2 enhanced disease susceptibility1

Expression Patterns of Glyma06g19890
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g19890 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g187200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g19890
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g19890
>Glyma06g19890.1   sequence type=CDS   gene model=Glyma06g19890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACTCAAGTGATGAGAGGAGAGGTGATTGAGAAGGCTTATGCTGGGTCTTGGAAGGCTCACAAGTCCCCAGACAAGCCTTACCTTATTGAAAAGATCAACAGAAACGACCCTCAAGAAGTTATCTTTTGTTTTCCAGGATCAGGTGCTGTCAGGGATTGGTACTCTCAGAAAAACTTTGGTGAAACAAAAATAGATCTTGGTCTGTTTCCCTCACTCAGAAGCATTGGTATCGATGAACAAGCTTTGGTGAATGAGGCCTTTCAGAAAAAATTCCAAGAAATTTTGTCTGCCAAACCATCACTTGCGGATGAGGTGGAGAAAGCAATGAGTAAAAAGAAGCAAATAGTGTTTGCAGGACACTCCTCTGGTGGTGCGGTGGCTATTCTGGCAACCCTTTGGGCCTTGGAAAACTACCAACCTCCTAAATCACACGGTGGCATCCCTCCCCTGTGTGTAACCTTTGGTTCTCCCTTAGTTGGGAACCACATATTTTCCCATGCCACAAGGCGTGAAAATTGGTCTCACTACTTTTTTCACTATGTGATGAGATATGACATAGTGCCACGAATCCTCCTTGCTCCCCTCTCTTCCCTTGACCCAAAATTTGAACCAATTTCCCAGTCCTTCAACCCCAAATCCAAGTCTTTCATGAGTGACTCAGTGGGAAGAGCCAGTGCAGAAACAACTTCAGAGTTCTACTTTGCCATAATCTCAAATGCTGCAACTGTCACAAGCCATGCTGCTTCTAAGTTAATGGGAACCACAGATACCACATTAGAAACTTGGTCAAATTTCATTACCTTAAGCCCTTATAGGCCCTTTGGCACTTACTATTTCTGCACTGGAAATGGAAAGTCAGGGAAGAAAATTGTGATAACAAACTCAAATGCAGTTCTACAGGTCCTGTTTTTCTCTGCTCAATTAAGCACTGAAGCAGAAGCTGCTCAAGTTCCCTATAGGAGCTTACGAGATCATACAATTTATGGCACCGAACTGCAACAAATGGGGCCTCAGAATGTTGTGCACTTGGATCAACATCAGCTCCAGAATCTTCCTTTGTCTGAAGATGGTGCTGGTGGCTCAAATGCAACCATTAACACGGCCTTAAATGACCTTGGCCTGATTCCAAGAGCAAGACTGTGCCTCCGGGCAGCAGCAGAGTGGGAGGCAAGAAGAACTGACAACGAGAATAAGATCAAAGAGAAGAAAGATTTTGTTGCGAAAAAATTGGACGTTCTTCGGGAATACAGAAAAATGTATAAGGATAAAAGGGTGGGTTTTTACGATGGCTTCAGGGAGCATAAGCAAGGTGAGGATGACTTCAAAGCAAACGTGACGAGGCTAGAGCTGGCAGGTGTGTGGGACGAGATGATGGAAAAGGTAAGAAGTTATGAACTCCCAGATGAATTTGAAGGCAACAAAGATTACATTGACCTTGGAACTGAGCTTCGGAAACTTATGGAACCTCTGGATATTGCCAATTATTACCGACATGGGAGGAATTATGAGGACAGTTCTTCTTCTTACATGATTAAGGGAAGACCAAAACGATATAGATATCCTCAAAGATGGTTGGAACATGCTGAGAGAAAGTCACATGAATCTCTCTCAGCATCTTGCTTCTGGGCCGAGGTGGAAGAACTTCACTACAAGACAAGTAGGAGTAGTAACATTGTCTCATTGGATCAACAATTTAAGGAAAGGATTGAGAAATTAGAGATTCAAATAAAAGCATGGAGTGACAGAAAGGAACTAGATGAGGATGTCTTCTTGGAGGGTTCTACCTTGGTGAAGTGGTGGAAAGCACTTCCTCAACAACACAAGCAACATTCATGCATTAAAACTCTTATTAGAGAGTGA
Predicted protein sequences of Glyma06g19890
>Glyma06g19890.1   sequence type=predicted peptide   gene model=Glyma06g19890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTQVMRGEVIEKAYAGSWKAHKSPDKPYLIEKINRNDPQEVIFCFPGSGAVRDWYSQKNFGETKIDLGLFPSLRSIGIDEQALVNEAFQKKFQEILSAKPSLADEVEKAMSKKKQIVFAGHSSGGAVAILATLWALENYQPPKSHGGIPPLCVTFGSPLVGNHIFSHATRRENWSHYFFHYVMRYDIVPRILLAPLSSLDPKFEPISQSFNPKSKSFMSDSVGRASAETTSEFYFAIISNAATVTSHAASKLMGTTDTTLETWSNFITLSPYRPFGTYYFCTGNGKSGKKIVITNSNAVLQVLFFSAQLSTEAEAAQVPYRSLRDHTIYGTELQQMGPQNVVHLDQHQLQNLPLSEDGAGGSNATINTALNDLGLIPRARLCLRAAAEWEARRTDNENKIKEKKDFVAKKLDVLREYRKMYKDKRVGFYDGFREHKQGEDDFKANVTRLELAGVWDEMMEKVRSYELPDEFEGNKDYIDLGTELRKLMEPLDIANYYRHGRNYEDSSSSYMIKGRPKRYRYPQRWLEHAERKSHESLSASCFWAEVEELHYKTSRSSNIVSLDQQFKERIEKLEIQIKAWSDRKELDEDVFLEGSTLVKWWKALPQQHKQHSCIKTLIRE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo