Glyma06g19870 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g19870

Feature Type:	gene_model
Chromosome:	Gm06
Start:	16216106
stop:	16218521
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g19870

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G62920	AT	Annotation by Michelle Graham. TAIR10: response regulator 6 \| chr5:25252745-25254158 REVERSE LENGTH=186	SoyBase	E_val: 3.00E-74	ISS
GO:0000160	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphorelay signal transduction system	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007623	GO-bp	Annotation by Michelle Graham. GO Biological Process: circadian rhythm	SoyBase	N/A	ISS
GO:0009735	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus	SoyBase	N/A	ISS
GO:0009736	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0000156	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphorelay response regulator activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PTHR26402	Panther	RESPONSE REGULATOR OF TWO-COMPONENT SYSTEM	JGI		ISS
PTHR26402:SF62	Panther		JGI		ISS
PF00072	PFAM	Response regulator receiver domain	JGI		ISS
UniRef100_G7JNT1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Two-component response regulator ARR5 n=1 Tax=Medicago truncatula RepID=G7JNT1_MEDTR	SoyBase	E_val: 5.00E-90	ISS
UniRef100_I1KCL2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KCL2_SOYBN	SoyBase	E_val: 1.00E-142	ISS

Proteins Associated with Glyma06g19870

Locus	Gene Symbol	Protein Name
	RR14	Root Preferential, Response Regulator Type-A

Expression Patterns of Glyma06g19870

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g19870

Paralog	Evidence	Comments
Glyma04g34820	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g19870 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g187000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g19870

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g19870

Limit To All Plant Sequences

>Glyma06g19870.1   sequence type=CDS   gene model=Glyma06g19870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCGCCGGCGATCTTTTCACGCATGGTTTGCCGGAAGTTGGTGGTGCCGGGAAGTTACACGTGCTTGCTGTTGATGACAGCCACGTGGACCGCAAGGTGATCGAGCGGTTGCTCAAAATCTCGTCTTGCAAAGTGACGGTGGTGGAAAGTGGTAGCAGGGCTCTACAGTATCTGGGGTTGGATGGAGAAAAAAGTTCCATTGGTTTTGATAGTGTGGATGTTAATTTGATAATGACGGATTATTCCATGCCGGGGATGACAGGATACGAATTGCTCAAAAAGATTAAGGAGTCATCTGTTTTTAGAGAGGTTCCAGTGGTGGTTATGTCGTCTGAGAATATCTTGACCAGAATTGATAGTTGCTTGGAGGAAGGAGCAGAGGAGTTTCTGTTGAAACCTGTCAAGTTGTCAGATGTAAAACGCGTAACAGATTTCATCATGCGAGGCGAAGGGATGAAAGGAGTAAAAAGATCTAAAAAAAGAAGCCGATCAGATGATTGCATTCCATCTCTATCAACTGCATTTGCATCAGTTTCTCATCCATGTGATCTATCATCACCTCCATCACCATGTGTATCGCAATCGAAGAAATCTAGATTGAGCATATAG

Predicted protein sequences of Glyma06g19870

Limit To All Plant Sequences

>Glyma06g19870.1   sequence type=predicted peptide   gene model=Glyma06g19870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASAGDLFTHGLPEVGGAGKLHVLAVDDSHVDRKVIERLLKISSCKVTVVESGSRALQYLGLDGEKSSIGFDSVDVNLIMTDYSMPGMTGYELLKKIKESSVFREVPVVVMSSENILTRIDSCLEEGAEEFLLKPVKLSDVKRVTDFIMRGEGMKGVKRSKKRSRSDDCIPSLSTAFASVSHPCDLSSPPSPCVSQSKKSRLSI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain