SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g18985): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g18985): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g18985

Feature Type:gene_model
Chromosome:Gm06
Start:15223175
stop:15226976
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48210AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Kinetochore-Ndc80 complex, subunit Spc25 (InterPro:IPR013255); Has 194 Blast hits to 194 proteins in 72 species: Archae - 0; Bacteria - 4; Metazoa - 72; Fungi - 39; Plants - 62; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). | chr3:17849435-17851396 FORWARD LENGTH=315 SoyBaseE_val: 7.00E-41ISS
GO:0000724GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination SoyBaseN/AISS
GO:0006302GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0007059GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome segregation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007140GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0016444GO-bp Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG4657 KOG Uncharacterized conserved protein JGI ISS
PF08234PFAM Chromosome segregation protein Spc25 JGI ISS
UniRef100_I1JXA1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JXA1_SOYBN SoyBaseE_val: 3.00E-143ISS
UniRef100_Q93VK9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Kinetochore protein Spc25 n=1 Tax=Arabidopsis thaliana RepID=Q93VK9_ARATH SoyBaseE_val: 3.00E-38ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g18985 not represented in the dataset

Glyma06g18985 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g35960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g18985.1   sequence type=CDS   gene model=Glyma06g18985   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCAATCTGCGACACCGATATCCCTCTTCGACTACAGAACATCGACGCTCTCACCGCTTCTTACAGAAACTCTCTCCAATCACTGAGAACCACCGCACTCGAAACCGCGCGATCTCAATCCGAACTAACAGAGATTCAAGCTAAACTCAGAGAGGCTGAGGATGATTTGTGTTTTGGTTTGGTGTTGTGTTTTACTTTTCGTGCAGTTAAGACTCGGAGAGAGGCGAAGCGAATGGCGTTGAAAGCCGCGATTGATTCTGTGAAGGGAAGAATTGAAGATCTGAAGACGAGTATTCCGCAGCAGAGAACAAAAAACAAGGAATGTGCTACCGTTGTATCGCAGCACCGGCTTGGGAGATCCCCTAGCATCAAGGGGCTAGTTGAGCAGCTACGAGTAGTTTTGGCAGTGTCTGAACAGGAATCAAATGAAAGCAGTGAGCATAGAGATGAAGTCCAGGAGGCCATATCTTGGTACACAATAGGATCCTTGGTTTTCATGTTGAAGGTGGACGTGATCTTCTTCTTGTTAGGGGTAAAATTCACCTTCAAGAATATTAATGTGGACAACCCAAATGAGGAGTTCTTTTTTACCATCCGCCTTGAAGATGACATTTATACATTGCTAAATTGTAAACCATCTGTCAAAGATACTGACGAGGTGATCCATGAATTAAACAAGACAAATGGTCTATTTAAATTTGTCAGAACAATGAGGAAAAAGTTTCAAGAAGCAGTGGCACAAGTTTTATCAATATCAACCATTACTGAAGGAAATGAGAATCAAGATGAACCCATCAAAGGCAATGCACATCTCCAGAAACAAGTCAATCGAAGAAGGGTAAAATCTCCTGGATCTGCATCATCTGTTTGTCAATCTCCTCGTTTGAAGGTGTCAACTCAAATACTCAAGCTGTATCAGAAAGTGAGTTTAGGTAACTCAAACGTTTAA

>Glyma06g18985.1   sequence type=predicted peptide   gene model=Glyma06g18985   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASICDTDIPLRLQNIDALTASYRNSLQSLRTTALETARSQSELTEIQAKLREAEDDLCFGLVLCFTFRAVKTRREAKRMALKAAIDSVKGRIEDLKTSIPQQRTKNKECATVVSQHRLGRSPSIKGLVEQLRVVLAVSEQESNESSEHRDEVQEAISWYTIGSLVFMLKVDVIFFLLGVKFTFKNINVDNPNEEFFFTIRLEDDIYTLLNCKPSVKDTDEVIHELNKTNGLFKFVRTMRKKFQEAVAQVLSISTITEGNENQDEPIKGNAHLQKQVNRRRVKSPGSASSVCQSPRLKVSTQILKLYQKVSLGNSNV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo