SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g18120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g18120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g18120

Feature Type:gene_model
Chromosome:Gm06
Start:14430561
stop:14433504
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G13440AT Annotation by Michelle Graham. TAIR10: glyceraldehyde-3-phosphate dehydrogenase C2 | chr1:4608465-4610494 REVERSE LENGTH=338 SoyBaseE_val: 0ISS
GO:0006006GO-bp Annotation by Michelle Graham. GO Biological Process: glucose metabolic process SoyBaseN/AISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0051049GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transport SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004365GO-mf Annotation by Michelle Graham. GO Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG0657 KOG Glyceraldehyde 3-phosphate dehydrogenase JGI ISS
PTHR10836Panther GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE JGI ISS
PF00044PFAM Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain JGI ISS
PF02800PFAM Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain JGI ISS
UniRef100_I1KC70UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KC70_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q07CZ3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glyceraldehyde-3-dehydrogenase C subunit n=1 Tax=Glycine max RepID=Q07CZ3_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g18120 not represented in the dataset

Glyma06g18120 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g172700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g18120.1   sequence type=CDS   gene model=Glyma06g18120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCAAGGTCAAGATCGGAATCAACGGATTTGGAAGAATTGGCCGTTTGGTTGCCAGAGTCGCTCTGCAAAGAGACGATGTTGAACTCGTTGCCGTTAACGACCCTTTCATTACCACCGATTACATGACATACATGTTTAAATACGACAGTGTTCACGGACACTGGAAGCATCACGATGTCACCGTTAAGGACGAGAAGACCCTTCTCTTCGGTGACAAGGCAGTCACTGTTTTTGGACACAGAAACCCTGAAGAGATCCCATGGGGGTCAACTGGAGCTGACATCATTGTTGAGTCCACCGGAGTTTTCACCGATAAGGACAAGGCTGCCGCACATTTGAAGGGTGGTGCCAAGAAGGTTATTATTTCTGCCCCCAGTAAGGATGCCCCCATGTTTGTTGTTGGTGTTAATGAGCACGAGTACAAGCCAGAGCTTGATATTATTTCCAACGCTAGCTGCACAACCAACTGCCTTGCTCCACTCGCCAAGGTTATCAATGACAGGTTTGGCATTGTTGAGGGTTTGATGACCACTGTTCATTCCATCACTGCTACCCAGAAGACTGTTGATGGGCCATCAGCCAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTTAACATCATTCCTAGCAGCACTGGAGCTGCCAAGGCTGTTGGGAAAGTCCTTCCTGCTTTGAATGGAAAATTGACTGGTATGGCATTCCGTGTTCCCACCGTGGATGTCTCTGTTGTTGACCTCACGGTGAGGCTGGAGAAGGAAGCCTCATATGATGAAATTAAAAATGCTATCAAGGAGGAATCAGAGGGCAAGTTGAAGGGAATTCTTGGTTACACTGAAGATGATGTGGTCTCCACCGACTTTGTTGGTGATAACAGATCAAGTATTTTTGATGCAAAGGCTGGAATTGCATTGAATAAGAATTTTGTGAAGCTTGTCTCTTGGTATGACAACGAGTGGGGATACAGTTCACGTGTCATTGACCTGCTTGTAATCGTTGCCAAGAAGTCTTTTTAA

>Glyma06g18120.1   sequence type=predicted peptide   gene model=Glyma06g18120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKVKIGINGFGRIGRLVARVALQRDDVELVAVNDPFITTDYMTYMFKYDSVHGHWKHHDVTVKDEKTLLFGDKAVTVFGHRNPEEIPWGSTGADIIVESTGVFTDKDKAAAHLKGGAKKVIISAPSKDAPMFVVGVNEHEYKPELDIISNASCTTNCLAPLAKVINDRFGIVEGLMTTVHSITATQKTVDGPSAKDWRGGRAASFNIIPSSTGAAKAVGKVLPALNGKLTGMAFRVPTVDVSVVDLTVRLEKEASYDEIKNAIKEESEGKLKGILGYTEDDVVSTDFVGDNRSSIFDAKAGIALNKNFVKLVSWYDNEWGYSSRVIDLLVIVAKKSF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo