Glyma06g17091 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g17091

Feature Type:	gene_model
Chromosome:	Gm06
Start:	13437104
stop:	13439509
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g17091

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G51040	AT	Annotation by Michelle Graham. TAIR10: unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF339 (InterPro:IPR005631); Has 532 Blast hits to 532 proteins in 207 species: Archae - 0; Bacteria - 285; Metazoa - 16; Fungi - 41; Plants - 40; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). \| chr5:20750700-20751790 FORWARD LENGTH=188	SoyBase	E_val: 8.00E-69	ISS
GO:0009062	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process	SoyBase	N/A	ISS
GO:0080022	GO-bp	Annotation by Michelle Graham. GO Biological Process: primary root development	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0008177	GO-mf	Annotation by Michelle Graham. GO Molecular Function: succinate dehydrogenase (ubiquinone) activity	SoyBase	N/A	ISS
KOG3326	KOG	Uncharacterized conserved protein	JGI		ISS
PTHR12469	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR12469:SF1	Panther	gb def: hypothetical orf, yol071wp [saccharomyces cerevisiae]	JGI		ISS
PF03937	PFAM	Protein of unknown function (DUF339)	JGI		ISS
UniRef100_C6T1X3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T1X3_SOYBN	SoyBase	E_val: 3.00E-131	ISS
UniRef100_G7J2S2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Succinate dehydrogenase assembly factor n=1 Tax=Medicago truncatula RepID=G7J2S2_MEDTR	SoyBase	E_val: 5.00E-87	ISS

Expression Patterns of Glyma06g17091

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g17091 not represented in the dataset	Glyma06g17091 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g17091

Paralog	Evidence	Comments
Glyma04g37970	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g17091 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g162900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g17091

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g17091

Limit To All Plant Sequences

>Glyma06g17091.1   sequence type=CDS   gene model=Glyma06g17091   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAGTTTCAGAAACGCTGCGATCAACGTCTTCAGAGCGATCAATACTAACAAAGCCACCATCGCTGCTTCCACAAACTCTCTTCACACTCTCAGGCCCCTTTTTTGTTATTCTAGGTCTACCCCTTTCTCTTCCCACACTGAAGCTGAATCCCTGCAAATCGATTTATCTAACGAAGAAAGCAAAAGATGCTTGTTTAACCGGCTATTGTATAGAAGCAAACAACGAGGGTTCCTGGAACTCGATTTGGTCCTCGGGAAATGGGTTGAGGAAAACATTCACTCCTTGGATGAAAATCGGATTAAGGCTCTCATTCATGTTCTCGATCTGGAGAATCCAGACTTATGGAAGTGGATATCAGGACAGGAGCAACCCCCAGAATCAGTCAGCGCAAACCTGGTCTTTGCTGCAGTGCGGGAAAGAGTTAAGAAAAACCTTGATATCCATTCTGCTCCTGAAGTAAGAGCAACGCCTGGCCAACCATGGGTAAGAGGCTGGGATGATATCAAGAAAGGACAAGATGGTCCTGTTTCTGGAAATCAGTAG

Predicted protein sequences of Glyma06g17091

Limit To All Plant Sequences

>Glyma06g17091.1   sequence type=predicted peptide   gene model=Glyma06g17091   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASFRNAAINVFRAINTNKATIAASTNSLHTLRPLFCYSRSTPFSSHTEAESLQIDLSNEESKRCLFNRLLYRSKQRGFLELDLVLGKWVEENIHSLDENRIKALIHVLDLENPDLWKWISGQEQPPESVSANLVFAAVRERVKKNLDIHSAPEVRATPGQPWVRGWDDIKKGQDGPVSGNQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain