SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g17091): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g17091): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g17091

Feature Type:gene_model
Chromosome:Gm06
Start:13437104
stop:13439509
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G51040AT Annotation by Michelle Graham. TAIR10: unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF339 (InterPro:IPR005631); Has 532 Blast hits to 532 proteins in 207 species: Archae - 0; Bacteria - 285; Metazoa - 16; Fungi - 41; Plants - 40; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). | chr5:20750700-20751790 FORWARD LENGTH=188 SoyBaseE_val: 8.00E-69ISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0080022GO-bp Annotation by Michelle Graham. GO Biological Process: primary root development SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0008177GO-mf Annotation by Michelle Graham. GO Molecular Function: succinate dehydrogenase (ubiquinone) activity SoyBaseN/AISS
KOG3326 KOG Uncharacterized conserved protein JGI ISS
PTHR12469Panther FAMILY NOT NAMED JGI ISS
PTHR12469:SF1Panther gb def: hypothetical orf, yol071wp [saccharomyces cerevisiae] JGI ISS
PF03937PFAM Protein of unknown function (DUF339) JGI ISS
UniRef100_C6T1X3UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6T1X3_SOYBN SoyBaseE_val: 3.00E-131ISS
UniRef100_G7J2S2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Succinate dehydrogenase assembly factor n=1 Tax=Medicago truncatula RepID=G7J2S2_MEDTR SoyBaseE_val: 5.00E-87ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g17091 not represented in the dataset

Glyma06g17091 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g37970 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g162900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g17091.1   sequence type=CDS   gene model=Glyma06g17091   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAGTTTCAGAAACGCTGCGATCAACGTCTTCAGAGCGATCAATACTAACAAAGCCACCATCGCTGCTTCCACAAACTCTCTTCACACTCTCAGGCCCCTTTTTTGTTATTCTAGGTCTACCCCTTTCTCTTCCCACACTGAAGCTGAATCCCTGCAAATCGATTTATCTAACGAAGAAAGCAAAAGATGCTTGTTTAACCGGCTATTGTATAGAAGCAAACAACGAGGGTTCCTGGAACTCGATTTGGTCCTCGGGAAATGGGTTGAGGAAAACATTCACTCCTTGGATGAAAATCGGATTAAGGCTCTCATTCATGTTCTCGATCTGGAGAATCCAGACTTATGGAAGTGGATATCAGGACAGGAGCAACCCCCAGAATCAGTCAGCGCAAACCTGGTCTTTGCTGCAGTGCGGGAAAGAGTTAAGAAAAACCTTGATATCCATTCTGCTCCTGAAGTAAGAGCAACGCCTGGCCAACCATGGGTAAGAGGCTGGGATGATATCAAGAAAGGACAAGATGGTCCTGTTTCTGGAAATCAGTAG

>Glyma06g17091.1   sequence type=predicted peptide   gene model=Glyma06g17091   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASFRNAAINVFRAINTNKATIAASTNSLHTLRPLFCYSRSTPFSSHTEAESLQIDLSNEESKRCLFNRLLYRSKQRGFLELDLVLGKWVEENIHSLDENRIKALIHVLDLENPDLWKWISGQEQPPESVSANLVFAAVRERVKKNLDIHSAPEVRATPGQPWVRGWDDIKKGQDGPVSGNQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo