Glyma06g15220 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g15220

Feature Type:	gene_model
Chromosome:	Gm06
Start:	11960799
stop:	11964431
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g15220

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G64810	AT	Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 51 \| chr5:25908415-25909687 FORWARD LENGTH=194	SoyBase	E_val: 9.00E-43	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF03106	PFAM	WRKY DNA -binding domain	JGI		ISS
UniRef100_I1KBC5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1KBC5_SOYBN	SoyBase	E_val: 2.00E-145	ISS
UniRef100_Q2PJS3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WRKY21 n=1 Tax=Glycine max RepID=Q2PJS3_SOYBN	SoyBase	E_val: 2.00E-112	ISS

Proteins Associated with Glyma06g15220

Locus	Gene Symbol	Protein Name
	WRKY61	WRKY Transcription Factor

Expression Patterns of Glyma06g15220

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g15220

Paralog	Evidence	Comments
Glyma04g39650	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g15220 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g147100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g15220

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g15220

Limit To All Plant Sequences

>Glyma06g15220.1   sequence type=CDS   gene model=Glyma06g15220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATTACTATTTTGGAAACCTTAATCCTAACCCTTATTACCATCACTCTGCCGTAGTGAACATGGCATCTCCCTCCTCCGAGTTCATGTTATCTGATTATCTCGTGTTGGAAGATGCTCTTGTTGTTGATCATCATCAAGAGTCTTGGTCACAAAGCACTGAAACTGAATCGTCGGAGAAAGCAACCTCCAGCGATGCAAGTCATGGGTTCGGTGATGCAACCTCCAACACCAACATGCATATAAAGTGCCAAAATAGTGGGATTAAGGGAAAGAATGCAGAAGTGAGTCAAAGGATAACGTTTAGAACCAGATCGCAACTTGAGGTTATGGATGATGGATATAAATGGAGGAAATACGGGAAGAAAACAGTGAAGAGCAGTCCCAACCCACGGAACTACTACAAGTGTTCAGGTGAAGGATGCGATGTGAAGAAAAGGGTGGAAAGGGATAGGGATGACTCCAACTATGTGTTAACAACGTACGACGGTGTCCACAATCATCAGACCCCGTCTACTGCCTACTACAGCCAAATGCCCTTGCTGCATTCTAATCATGATTGGGCCCTCCACCCTTCTGCAAACTCATAA

Predicted protein sequences of Glyma06g15220

Limit To All Plant Sequences

>Glyma06g15220.1   sequence type=predicted peptide   gene model=Glyma06g15220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDYYFGNLNPNPYYHHSAVVNMASPSSEFMLSDYLVLEDALVVDHHQESWSQSTETESSEKATSSDASHGFGDATSNTNMHIKCQNSGIKGKNAEVSQRITFRTRSQLEVMDDGYKWRKYGKKTVKSSPNPRNYYKCSGEGCDVKKRVERDRDDSNYVLTTYDGVHNHQTPSTAYYSQMPLLHSNHDWALHPSANS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain