Report for Sequence Feature Glyma06g14880
Feature Type: gene_model
Chromosome: Gm06
Start: 11677096
stop: 11678629
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g14880
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G56290 AT
Annotation by Michelle Graham. TAIR10: unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:20878743-20879541 REVERSE LENGTH=173
SoyBase E_val: 2.00E-68 ISS
GO:0009658 GO-bp
Annotation by Michelle Graham. GO Biological Process: chloroplast organization
SoyBase N/A ISS
GO:0010264 GO-bp
Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_I1KB88 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KB88_SOYBN
SoyBase E_val: 2.00E-122 ISS
UniRef100_Q00SR8 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: WGS project CAID00000000 data, contig chromosome 18 n=1 Tax=Ostreococcus tauri RepID=Q00SR8_OSTTA
SoyBase E_val: 7.00E-11 ISS
Expression Patterns of Glyma06g14880
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma06g14880
Paralog Evidence Comments
Glyma04g39970 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g14880 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g143700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g14880
Coding sequences of Glyma06g14880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g14880.1 sequence type=CDS gene model=Glyma06g14880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGGACTTGGGACTCTGCCACTGACCCCTTCTTACAGCAGTTTCTCTTCAAAGTCAGGAGGGCTTTTACATGACATCACCAATCACAGCAGGGTTAATAGAAGCATGAAATTCAGAGTTTCAGCCAAACAAGAGAAGCAAGAAGAGAAGAAAAAGCAATCTTTGTTCAGCAGTGTGACTGAAGCTCTTGATTTTTCTCAAGTGAGATCTGCTGAGGATGCTCAGCTTATAGAAGAGGCTAGAGAAGCCACAAGATCGGGAGAAAGGATGAGTAGGGAACAGTATGGAGCTCTTAGAAGGAAAATTGGTGGTACATACAAGGATTTTTTCAAATCTTACGTTGAAGTGGACGGGGCATATGTAGAAGAGGGATGGGTTGACAAAACATGCAAGGTGTGCAAGAAGGATACTAAGGGCGAGGCAAGGCAAGTGGACAAGCTTGGAAGATATGTTCATGTAGCATGTCTAGAGAAGGCCAATGCAGGAAACTTCTTTACCAGACTCTTCTCTAGATAA
Predicted protein sequences of Glyma06g14880
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g14880.1 sequence type=predicted peptide gene model=Glyma06g14880 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MGLGTLPLTPSYSSFSSKSGGLLHDITNHSRVNRSMKFRVSAKQEKQEEKKKQSLFSSVTEALDFSQVRSAEDAQLIEEAREATRSGERMSREQYGALRRKIGGTYKDFFKSYVEVDGAYVEEGWVDKTCKVCKKDTKGEARQVDKLGRYVHVACLEKANAGNFFTRLFSR*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
