SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma06g14880

Feature Type:gene_model
Chromosome:Gm06
Start:11677096
stop:11678629
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G56290AT Annotation by Michelle Graham. TAIR10: unknown protein; Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:20878743-20879541 REVERSE LENGTH=173 SoyBaseE_val: 2.00E-68ISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0010264GO-bp Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_I1KB88UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KB88_SOYBN SoyBaseE_val: 2.00E-122ISS
UniRef100_Q00SR8UniRef Annotation by Michelle Graham. Most informative UniRef hit: WGS project CAID00000000 data, contig chromosome 18 n=1 Tax=Ostreococcus tauri RepID=Q00SR8_OSTTA SoyBaseE_val: 7.00E-11ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g39970 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g143700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g14880.1   sequence type=CDS   gene model=Glyma06g14880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGACTTGGGACTCTGCCACTGACCCCTTCTTACAGCAGTTTCTCTTCAAAGTCAGGAGGGCTTTTACATGACATCACCAATCACAGCAGGGTTAATAGAAGCATGAAATTCAGAGTTTCAGCCAAACAAGAGAAGCAAGAAGAGAAGAAAAAGCAATCTTTGTTCAGCAGTGTGACTGAAGCTCTTGATTTTTCTCAAGTGAGATCTGCTGAGGATGCTCAGCTTATAGAAGAGGCTAGAGAAGCCACAAGATCGGGAGAAAGGATGAGTAGGGAACAGTATGGAGCTCTTAGAAGGAAAATTGGTGGTACATACAAGGATTTTTTCAAATCTTACGTTGAAGTGGACGGGGCATATGTAGAAGAGGGATGGGTTGACAAAACATGCAAGGTGTGCAAGAAGGATACTAAGGGCGAGGCAAGGCAAGTGGACAAGCTTGGAAGATATGTTCATGTAGCATGTCTAGAGAAGGCCAATGCAGGAAACTTCTTTACCAGACTCTTCTCTAGATAA

>Glyma06g14880.1   sequence type=predicted peptide   gene model=Glyma06g14880   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGLGTLPLTPSYSSFSSKSGGLLHDITNHSRVNRSMKFRVSAKQEKQEEKKKQSLFSSVTEALDFSQVRSAEDAQLIEEAREATRSGERMSREQYGALRRKIGGTYKDFFKSYVEVDGAYVEEGWVDKTCKVCKKDTKGEARQVDKLGRYVHVACLEKANAGNFFTRLFSR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo