Glyma06g14720 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g14720

Feature Type:	gene_model
Chromosome:	Gm06
Start:	11533270
stop:	11536206
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g14720

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G56400	AT	Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 70 \| chr3:20909082-20910409 REVERSE LENGTH=294	SoyBase	E_val: 1.00E-45	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0001666	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hypoxia	SoyBase	N/A	ISS
GO:0002679	GO-bp	Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009625	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to insect	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009751	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009759	GO-bp	Annotation by Michelle Graham. GO Biological Process: indole glucosinolate biosynthetic process	SoyBase	N/A	ISS
GO:0009814	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009864	GO-bp	Annotation by Michelle Graham. GO Biological Process: induced systemic resistance, jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010120	GO-bp	Annotation by Michelle Graham. GO Biological Process: camalexin biosynthetic process	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0019684	GO-bp	Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction	SoyBase	N/A	ISS
GO:0031347	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of defense response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0035304	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043069	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0045088	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response	SoyBase	N/A	ISS
GO:0045892	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0051707	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to other organism	SoyBase	N/A	ISS
GO:1900056	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of leaf senescence	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF03106	PFAM	WRKY DNA -binding domain	JGI		ISS
UniRef100_B0LUS3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor n=1 Tax=Glycine max RepID=B0LUS3_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1KB70	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KB70_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma06g14720

Locus	Gene Symbol	Protein Name
	WRKY97	WRKY Transcription Factor

Expression Patterns of Glyma06g14720

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g14720

Paralog	Evidence	Comments
Glyma04g40130	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g14720 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g142000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g14720

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g14720

Limit To All Plant Sequences

>Glyma06g14720.1   sequence type=CDS   gene model=Glyma06g14720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTATTCTCTTCCCAAGAAGTTCCTCAGCAGCAAAGAGGAAAAGGGTCATTAGAGAACTTGTTCAGGGTCGAGACTATGCTACTCAGTTGAAGTTTCTGCTTCAGAAGCCTATTGGCCCTGATGGGTCTGTTTCTGCTAAGGAACTTGTGGCCAATGTGCTGAGATCTTTCGCTGAAACTCTCTCTGTGTTGACTTCTTCTTCCGAGGATTCAACAAGTGGTCATGATCATGACGACGAGGTTATTGCTCAGAATCTTGTAATTTCCGGAGAAGATGCCTCGCAGGTGGCAAGCATTAATGATCCGAGTTCTGAGGATTCGACTGAGAGTAGGAAGGGATCAAAGGATCGGAGAGGGTCCTATAAAAGAAGGAAGACTGAACAGACATGGACTATAGTTGCCCAAACTACTGATGATAATCATGCATGGAGAAAGTACGGACAAAAGGAAATCCTAAATTCTCAATTTCCCAGGAGTTACTTCAGGTGCACTAGAAAGTTTGAACAAGGTTGCCGAGCAACCAAACAAGTGCAACGGATACAAGAGAATCCCGATAGGTACAACATTACGTACATAGGCTTTCACACATGCAAAGACACCCTCAAGGCTCCACAAGTGGTGACACATTCTAAAACTTGGGACTCATTTCTTGGTCCTGAATCAAATGTGCCAAATGAACATTATTCCACCATTGGATCACAAAGCCAAATTGTAATACAAGAATATCCCAACGATGAGACTGATCCAAGTGATCTCACAGATGCTAACCTGTGGTCTGATTTGAAGGATTTTGAACTATCCAATGACAAGCCTGCAGGTTTGAAAATAGCACCTGAAAATGCAGATTCTGTGTATTCATGCACTGGCTCGAGAAGTTTGGACATGGATTTTGGGATATTCTCTCCTCATTTCTGCAGCACCGAGGACTTCCACTTTGATGAAAGCCAATTGCTTTAG

Predicted protein sequences of Glyma06g14720

Limit To All Plant Sequences

>Glyma06g14720.1   sequence type=predicted peptide   gene model=Glyma06g14720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSILFPRSSSAAKRKRVIRELVQGRDYATQLKFLLQKPIGPDGSVSAKELVANVLRSFAETLSVLTSSSEDSTSGHDHDDEVIAQNLVISGEDASQVASINDPSSEDSTESRKGSKDRRGSYKRRKTEQTWTIVAQTTDDNHAWRKYGQKEILNSQFPRSYFRCTRKFEQGCRATKQVQRIQENPDRYNITYIGFHTCKDTLKAPQVVTHSKTWDSFLGPESNVPNEHYSTIGSQSQIVIQEYPNDETDPSDLTDANLWSDLKDFELSNDKPAGLKIAPENADSVYSCTGSRSLDMDFGIFSPHFCSTEDFHFDESQLL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain