SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g14453

Feature Type:gene_model
Chromosome:Gm06
Start:11351532
stop:11356930
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g14453
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36910AT Annotation by Michelle Graham. TAIR10: ATP binding cassette subfamily B1 | chr2:15502162-15507050 FORWARD LENGTH=1286 SoyBaseE_val: 3.00E-126ISS
GO:0006200GO-bp Annotation by Michelle Graham. GO Biological Process: ATP catabolic process SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009624GO-bp Annotation by Michelle Graham. GO Biological Process: response to nematode SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009639GO-bp Annotation by Michelle Graham. GO Biological Process: response to red or far red light SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009958GO-bp Annotation by Michelle Graham. GO Biological Process: positive gravitropism SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010540GO-bp Annotation by Michelle Graham. GO Biological Process: basipetal auxin transport SoyBaseN/AISS
GO:0010541GO-bp Annotation by Michelle Graham. GO Biological Process: acropetal auxin transport SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0048364GO-bp Annotation by Michelle Graham. GO Biological Process: root development SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005516GO-mf Annotation by Michelle Graham. GO Molecular Function: calmodulin binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0010329GO-mf Annotation by Michelle Graham. GO Molecular Function: auxin efflux transmembrane transporter activity SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0042626GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances SoyBaseN/AISS
PTHR24221Panther FAMILY NOT NAMED JGI ISS
PTHR24221:SF96Panther JGI ISS
PF00005PFAM ABC transporter JGI ISS
PF00664PFAM ABC transporter transmembrane region JGI ISS
UniRef100_G7J9Q4UniRef Annotation by Michelle Graham. Most informative UniRef hit: ABC transporter ATP-binding protein/permease n=1 Tax=Medicago truncatula RepID=G7J9Q4_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1KB46UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KB46_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g14453
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g14453 not represented in the dataset
Glyma06g14453 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g14453 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma06g14453
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g14453
>Glyma06g14453.1   sequence type=CDS   gene model=Glyma06g14453   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCCTCAAAACGTTTTACAAATGGTAGACACTAATATTGCTGATGAAAAAGATGAACCTAAGAAGAAAGTGGTTAAAACTTTGTCATTCTTCAAACTCATGAGCTATGCTGACGTGATAGACTGGATTCTGATGGGTTTGGGAGGTCTAGGTTCGGTTGTGCATGGCATGGCATTTCCTGTTGGGTATCTCTTGTTGGGAAAAGCTCTTAATGCTTTTGGAAACAATATCAACGACATAGATGCCATGGTTAATGCTCTTAAAAAGGTTGTTCCATATGTGTGGTATATGGCCATCGCAACATTTCCTGCTGGGGTACTTGAGATTAGTTGTTGGATGTATGCAAGTGAAAGACAGTTATTTCAGCTAAGATTAGCATATCTAAGAGCAGTCCTCAACCAAGAGATAGGTGCTTTTGATACAGAATTAACAAGTGCAAAAGTCATCAGTGGAATAAGCAAGCACATGAGTGTCATACAAGATGCCATTGGTGAGAAGTTGGGTCACTTCACCTCTAGCTGTGCAACTTTCTTTGCTGGAATTGTGATTGCTGCCATATGCTGTTGGGAAGTAACGCTTCTTTGTTTAGTGGTTGTTCCGCTTATTCTTATAATAGGGGCAACTTACACCAAGAAAATGAACAGCATATCAACCACCAAAATGCTTTTCCATTCTGAAGCTACATCTATGATAGAGCAGACAATATCACAAATAAAAACAGTTTATGCTTTTGTTGGAGAGAGCTCTGCAATCAAATCCTTTACAGAGAACATGGAAAAACAATACGTTATAAGCAAAGGGGAGGCACTTGTGAAGGGAGTTGGGACAGGGATGTTTCAAACAGTGAGTTTCTGTTCTTGGGCTCTCATTGTATGGGTTGGAGCTGTTGTGGTCAGAGCCGGAAGAGCAACCGGAGGAGACATAATAACTGCAGTGATGAGTATTCTCTTTGGTGCCATATCTCTCACTTATGCAGCACCAGACATGCAAATATTTAATCAGGCAAAAGCTGCAGGATACGAAGTTTTTCAAGTGATCCAAAGAAAGCCTCTAATAAGTAATGAATCAGAAGGGATGATGCCTAGCAAAATCAAAGGTGACATTGAATTACGAGAAGTTCACTTTTCCTACCCATCACGGCCAGAGAAAGCAATCCTTCAAGGACTGTCCTTGTCAATTCCAGCAGGAAAGACAATAGCACTAGTTGGTAGCAGTGGCTGTGGAAAGAGCACTGTTATTTCCCTGGTTAGCAGATTTTATGACCCCTCGAGAGGAGAAATTTTTATTGATCATCACAATATAAAGGATCTCAATCTGAAGTTCCTGCGAAGAAATATAGGGGCTGTTTCCCAAGAACCATCACTCTTTGCTGGCACCATCAAGGATAATTTGAAAGTGGGAAAAATGGACGCAGATGATCAACAAATTCAGAAGGCAGCAGTAATGTCAAATGCACACTCTTTCATATCACAGCTGCCTAATCAGTACCTAACAGAGAAATACAGAAGAAAGGAGGACAGTAAGGAAGTAATAGAGATATAA
Predicted protein sequences of Glyma06g14453
>Glyma06g14453.1   sequence type=predicted peptide   gene model=Glyma06g14453   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPQNVLQMVDTNIADEKDEPKKKVVKTLSFFKLMSYADVIDWILMGLGGLGSVVHGMAFPVGYLLLGKALNAFGNNINDIDAMVNALKKVVPYVWYMAIATFPAGVLEISCWMYASERQLFQLRLAYLRAVLNQEIGAFDTELTSAKVISGISKHMSVIQDAIGEKLGHFTSSCATFFAGIVIAAICCWEVTLLCLVVVPLILIIGATYTKKMNSISTTKMLFHSEATSMIEQTISQIKTVYAFVGESSAIKSFTENMEKQYVISKGEALVKGVGTGMFQTVSFCSWALIVWVGAVVVRAGRATGGDIITAVMSILFGAISLTYAAPDMQIFNQAKAAGYEVFQVIQRKPLISNESEGMMPSKIKGDIELREVHFSYPSRPEKAILQGLSLSIPAGKTIALVGSSGCGKSTVISLVSRFYDPSRGEIFIDHHNIKDLNLKFLRRNIGAVSQEPSLFAGTIKDNLKVGKMDADDQQIQKAAVMSNAHSFISQLPNQYLTEKYRRKEDSKEVIEI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo