Report for Sequence Feature Glyma06g14241
Feature Type: gene_model
Chromosome: Gm06
Start: 11223922
stop: 11225400
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g14241
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G27660 AT
Annotation by Michelle Graham. TAIR10: unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G54150.1); Has 115 Blast hits to 109 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). | chr4:13817249-13818027 REVERSE LENGTH=182
SoyBase E_val: 1.00E-38 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0009560 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
UniRef100_Q337M3 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=3 Tax=Oryza RepID=Q337M3_ORYSJ
SoyBase E_val: 6.00E-19 ISS
UniRef100_UPI0001BA8A0A UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI0001BA8A0A related cluster n=1 Tax=unknown RepID=UPI0001BA8A0A
SoyBase E_val: 1.00E-114 ISS
Expression Patterns of Glyma06g14241
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma06g14241
Paralog Evidence Comments
Glyma04g40560 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g14241 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g137600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g14241
Coding sequences of Glyma06g14241
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g14241.1 sequence type=CDS gene model=Glyma06g14241 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATAACGGTCATATTCTTCCGGAAATCGATTATTCAGAATTTTGAATTTGATTGGCTATTCCACTCCCCTATATATTTTGTGTTATGTTCATCATCGTTGTTTCTTGACTCTCCGTTTAACCCTAAGCGGATTGTTGTGACTTGTGAAAGAGAAGAAGAAATTACGATGAAAACACCCACCACCAAAGTGGTGAATCTGAAGACGAAAAAGTCCCTTTCGAAACGTCCACGACTACAAGATGTCATCGACATCGACACCCCCATCAGGGCCATAGCTTGTCTCAAAAAAATCGACGACATGCGCCGCTTCGAGGAAACCGAGGATTGCTTCATCCTAGGTTTCGACCCTTACGCCGCCGTTGGCCTCTCGGTTGATTCTTCTGCCGATGATGTCTCCGTCATTGCTGAAAAGGGCAAGGTTGCTTGCAGAGATTACCCCCACTCAAGACATTTGTGTCTCAAATTCCCGTTTAAGACCACGCCTCATGAGAGCTATTGTGAAAAGTGCTATTGTTATGTTTGCGATAAGGTTGCCCCGTGTAAGGACTGGAAGGGCTGGCATTGCAATGCAGAGAGTGGTATTTACTGGAAGAATCAAAGGAATGTGAAGAAAATTCAACCAGCGCGTCTCTATTATTCTCAACCATAA
Predicted protein sequences of Glyma06g14241
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g14241.1 sequence type=predicted peptide gene model=Glyma06g14241 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MITVIFFRKSIIQNFEFDWLFHSPIYFVLCSSSLFLDSPFNPKRIVVTCEREEEITMKTPTTKVVNLKTKKSLSKRPRLQDVIDIDTPIRAIACLKKIDDMRRFEETEDCFILGFDPYAAVGLSVDSSADDVSVIAEKGKVACRDYPHSRHLCLKFPFKTTPHESYCEKCYCYVCDKVAPCKDWKGWHCNAESGIYWKNQRNVKKIQPARLYYSQP*