Glyma06g14180 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g14180

Feature Type:	gene_model
Chromosome:	Gm06
Start:	11175287
stop:	11177167
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g14180

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G24520	AT	Annotation by Michelle Graham. TAIR10: Transducin/WD40 repeat-like superfamily protein \| chr5:8371708-8372733 REVERSE LENGTH=341	SoyBase	E_val: 0	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009957	GO-bp	Annotation by Michelle Graham. GO Biological Process: epidermal cell fate specification	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0010026	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome differentiation	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0032880	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein localization	SoyBase	N/A	ISS
GO:0045165	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell fate commitment	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0290	KOG	Conserved WD40 repeat-containing protein AN11	JGI		ISS
PTHR19919	Panther	WD REPEAT CONTAINING PROTEIN	JGI		ISS
PF00400	PFAM	WD domain, G-beta repeat	JGI		ISS
UniRef100_C0A1G9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WD40 repeats protein LjTTG1 n=1 Tax=Lotus japonicus RepID=C0A1G9_LOTJA	SoyBase	E_val: 0	ISS
UniRef100_I1KB20	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KB20_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g14180

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g14180

Paralog	Evidence	Comments
Glyma04g40610	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g14180 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g136900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g14180

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g14180

Limit To All Plant Sequences

>Glyma06g14180.1   sequence type=CDS   gene model=Glyma06g14180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAATTCGACCGAAGAATCCCATCTCCGATCGGAAAACTCCGTCACTTACGAGTCCCCTTACCCTATCTACGGCATGTCATTCTCCCCCTCCCACCCCCACCGCCTCGCCCTCGGCAGCTTCATCGAAGAATACAACAACCGCGTCGACATCCTCTCTTTCCACCCTGACACCCTTTCGGTAACTCCCCACCCTTCTCTCTCCTTCGACCACCCTTACCCTCCCACCAAACTCATGTTCCACCCCCGCAAACCCTCCCCTTCCTCTTCCTCCGACCTCCTCGCCACCTCCGGCGACTACCTCCGCCTCTGGGAGATCCGTGATAACTCCGTGGATGCCGTCTCCCTCTTCAACAACAGCAAGACCAGCGAGTTCTGCGCCCCCTTAACCTCTTTCGACTGGAACGACATCGACCCCAACCGCATCGCCACCTCCAGCATCGACACCACCTGCACCATCTGGGACATCGAACGCACCCTCGTCGAAACCCAACTCATCGCTCACGACAAGGAGGTTTACGACATCGCCTGGGGAGAGGCCAGAGTCTTCGCCTCCGTCTCCGCCGACGGCTCCGTTAGAATCTTCGACCTTCGCGACAAGGAGCACTCCACCATCATCTACGAGAGCCCCCACCCTGACACCCCTTTGCTCCGCTTGGCTTGGAACAAACAGGACCTGAGGTACATGGCCACCATTTTAATGGACAGTAATAAAGTTGTGATTTTGGATATTAGGTCTCCCACTACCCCTGTTGCGGAGTTAGAGAGGCACCGTGGGAGTGTGAACGCCATTGCTTGGGCTCCTCATAGCTCCACGCATATTTGTTCTGCTGGTGATGATACTCAGGCTCTTATTTGGGAATTGCCCACGCTTGCTTCTCCCACTGGGATTGATCCCGTCTGCATGTACTCTGCTGGCTGTGAAATTAACCAGCTGCAGTGGTCCGCCGCCCAGCCCGATTGGATTGCCATTGCTTTTGCCAACAAGATGCAGCTTTTGAAGGTTTGA

Predicted protein sequences of Glyma06g14180

Limit To All Plant Sequences

>Glyma06g14180.1   sequence type=predicted peptide   gene model=Glyma06g14180   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENSTEESHLRSENSVTYESPYPIYGMSFSPSHPHRLALGSFIEEYNNRVDILSFHPDTLSVTPHPSLSFDHPYPPTKLMFHPRKPSPSSSSDLLATSGDYLRLWEIRDNSVDAVSLFNNSKTSEFCAPLTSFDWNDIDPNRIATSSIDTTCTIWDIERTLVETQLIAHDKEVYDIAWGEARVFASVSADGSVRIFDLRDKEHSTIIYESPHPDTPLLRLAWNKQDLRYMATILMDSNKVVILDIRSPTTPVAELERHRGSVNAIAWAPHSSTHICSAGDDTQALIWELPTLASPTGIDPVCMYSAGCEINQLQWSAAQPDWIAIAFANKMQLLKV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain