SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma06g13710

Feature Type:gene_model
Chromosome:Gm06
Start:10837819
stop:10838509
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G26340AT Annotation by Michelle Graham. TAIR10: cytochrome B5 isoform A | chr1:9113992-9114755 FORWARD LENGTH=135 SoyBaseE_val: 3.00E-50ISS
GO:0009707GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast outer membrane SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0537 KOG Cytochrome b5 JGI ISS
PTHR19359Panther CYTOCHROME B5 JGI ISS
PF00173PFAM Cytochrome b5-like Heme/Steroid binding domain JGI ISS
UniRef100_C6T218UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T218_SOYBN SoyBaseE_val: 6.00E-84ISS
UniRef100_G7JZ43UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome b5 n=1 Tax=Medicago truncatula RepID=G7JZ43_MEDTR SoyBaseE_val: 3.00E-54ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g131900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g13710.1   sequence type=CDS   gene model=Glyma06g13710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCAACCCTCACCAATTTCTACTCCATCAAAGATTTATCCCAGCACACTACCAAAGACGATTGCTGGATCCTCGTTGATGGAAAGGTATACGACGTGACACAGTATTTGGATGATCATCCCGGTGGAGATGATGTAATCCTCGCCGCAACCGGGAAAGACGCAACAGAAGAATTTGAAGATGCTGGCCACAGCAAAAGTGCTAGAGAACATATGGAGCAGTATTGTATTGGTGAGCTTGACACATCTTCTCCAATTTCCACCAAAGAAAAGTTCATACAACTCACTAAGCAATATTGGGTTGTTCCGGCAACCGTCGTCGGTATCTCGGTGGTAGTAGCTTTCTTATACTTACGTAAGAAGTAG

>Glyma06g13710.1   sequence type=predicted peptide   gene model=Glyma06g13710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPTLTNFYSIKDLSQHTTKDDCWILVDGKVYDVTQYLDDHPGGDDVILAATGKDATEEFEDAGHSKSAREHMEQYCIGELDTSSPISTKEKFIQLTKQYWVVPATVVGISVVVAFLYLRKK*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo