Glyma06g13710 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g13710

Feature Type:	gene_model
Chromosome:	Gm06
Start:	10837819
stop:	10838509
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g13710

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G26340	AT	Annotation by Michelle Graham. TAIR10: cytochrome B5 isoform A \| chr1:9113992-9114755 FORWARD LENGTH=135	SoyBase	E_val: 3.00E-50	ISS
GO:0009707	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast outer membrane	SoyBase	N/A	ISS
GO:0010319	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: stromule	SoyBase	N/A	ISS
GO:0020037	GO-mf	Annotation by Michelle Graham. GO Molecular Function: heme binding	SoyBase	N/A	ISS
KOG0537	KOG	Cytochrome b5	JGI		ISS
PTHR19359	Panther	CYTOCHROME B5	JGI		ISS
PF00173	PFAM	Cytochrome b5-like Heme/Steroid binding domain	JGI		ISS
UniRef100_C6T218	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T218_SOYBN	SoyBase	E_val: 6.00E-84	ISS
UniRef100_G7JZ43	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome b5 n=1 Tax=Medicago truncatula RepID=G7JZ43_MEDTR	SoyBase	E_val: 3.00E-54	ISS

Expression Patterns of Glyma06g13710

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g13710 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g131900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g13710

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g13710

Limit To All Plant Sequences

>Glyma06g13710.1   sequence type=CDS   gene model=Glyma06g13710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCAACCCTCACCAATTTCTACTCCATCAAAGATTTATCCCAGCACACTACCAAAGACGATTGCTGGATCCTCGTTGATGGAAAGGTATACGACGTGACACAGTATTTGGATGATCATCCCGGTGGAGATGATGTAATCCTCGCCGCAACCGGGAAAGACGCAACAGAAGAATTTGAAGATGCTGGCCACAGCAAAAGTGCTAGAGAACATATGGAGCAGTATTGTATTGGTGAGCTTGACACATCTTCTCCAATTTCCACCAAAGAAAAGTTCATACAACTCACTAAGCAATATTGGGTTGTTCCGGCAACCGTCGTCGGTATCTCGGTGGTAGTAGCTTTCTTATACTTACGTAAGAAGTAG

Predicted protein sequences of Glyma06g13710

Limit To All Plant Sequences

>Glyma06g13710.1   sequence type=predicted peptide   gene model=Glyma06g13710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPTLTNFYSIKDLSQHTTKDDCWILVDGKVYDVTQYLDDHPGGDDVILAATGKDATEEFEDAGHSKSAREHMEQYCIGELDTSSPISTKEKFIQLTKQYWVVPATVVGISVVVAFLYLRKK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain