Glyma06g13360 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g13360

Feature Type:	gene_model
Chromosome:	Gm06
Start:	10515528
stop:	10518321
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g13360

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G53400	AT	Annotation by Michelle Graham. TAIR10: HSP20-like chaperones superfamily protein \| chr5:21661588-21663383 FORWARD LENGTH=304	SoyBase	E_val: 3.00E-113	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009555	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen development	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0009880	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification	SoyBase	N/A	ISS
GO:0009965	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis	SoyBase	N/A	ISS
GO:0010450	GO-bp	Annotation by Michelle Graham. GO Biological Process: inflorescence meristem growth	SoyBase	N/A	ISS
GO:0032502	GO-bp	Annotation by Michelle Graham. GO Biological Process: developmental process	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0048448	GO-bp	Annotation by Michelle Graham. GO Biological Process: stamen morphogenesis	SoyBase	N/A	ISS
GO:0048833	GO-bp	Annotation by Michelle Graham. GO Biological Process: specification of floral organ number	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
KOG2265	KOG	Nuclear distribution protein NUDC	JGI		ISS
PTHR12356	Panther	NUCLEAR MOVEMENT PROTEIN NUDC	JGI		ISS
PF04969	PFAM	CS domain	JGI		ISS
UniRef100_B9RIH7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Nuclear movement protein nudc, putative n=1 Tax=Ricinus communis RepID=B9RIH7_RICCO	SoyBase	E_val: 2.00E-128	ISS
UniRef100_I1KAR6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KAR6_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g13360

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g13360

Paralog	Evidence	Comments
Glyma04g41480	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g13360 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g128000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g13360

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g13360

Limit To All Plant Sequences

>Glyma06g13360.1   sequence type=CDS   gene model=Glyma06g13360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGATTATCTCCGATTTCAACGAAGAGGAGCCGAAACCCGCTCACTCTTCACCACCGCAACCCCAATCCTCTTCTTCTTCGTCTTCGTTCAGTGCTACTTTTGACCGGTCAAATCCCATCGCTTTCCTGGAGAGAGTCTTCGAATTCGTCTCCGAACAGAGCGACTTTCTGGCGACGCAGAGCGCCGAGAAGGAGATAGTGTCGCTGGTGCACGCCGCCGGGAAGAAGAAGAGAGAGCTTCTCAAGGCGGAGAGAGAAAATGCCGATAAGAAGAAGAGAGAGGACCTCAAGGTCACGGAGGAGAGACAAAAGGTGGAGAAGAGATTGAATGAAGAGAAGGAACTCAAAGCCGAAGACACCAACAAAAACGAAAGCGCCTCCAGAGTTCCAAACAAAGGTAATGGCTTGGATCTGGAGAAATACTCTTGGACTCAGTCGCTTCAAGAGGTTAATGTGAATGTTCCGGTGCCAAATGGAACCAAATCGAGATTTGTTACCGTTGAGATAAAGAAGAACCATCTAAAAGTTGGACTCAAAGGCCAGCCTCCAATTATTGAGGGGGAGTTTCATAAGTCTGTCAAGCCTGATGATTGCTATTGGAGTATAGAGGATCAGAATTCAATTTCTATTCTTTTGACCAAGCATGATCAAATGGAATGGTGGAAATGTCTAGTGAAAGGTGATCCTGAAATTGATACCCAAAAGGTTGAACCTGAAAACAGCAAACTTGGTGACCTGGATCCTGAGACTCGACAGACTGTTGAAAAAATGATGTTTGACCAGAGGCAGAAGTCTATGGGCCTCCCTACCAGTGAAGAGCTCCAGAAGCAGGAAATGTTGAAGAAATTTATGTCTGAGCATCCGGAGATGGACTTTTCAAGGGCTAAAATATCATAA

Predicted protein sequences of Glyma06g13360

Limit To All Plant Sequences

>Glyma06g13360.1   sequence type=predicted peptide   gene model=Glyma06g13360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAIISDFNEEEPKPAHSSPPQPQSSSSSSSFSATFDRSNPIAFLERVFEFVSEQSDFLATQSAEKEIVSLVHAAGKKKRELLKAERENADKKKREDLKVTEERQKVEKRLNEEKELKAEDTNKNESASRVPNKGNGLDLEKYSWTQSLQEVNVNVPVPNGTKSRFVTVEIKKNHLKVGLKGQPPIIEGEFHKSVKPDDCYWSIEDQNSISILLTKHDQMEWWKCLVKGDPEIDTQKVEPENSKLGDLDPETRQTVEKMMFDQRQKSMGLPTSEELQKQEMLKKFMSEHPEMDFSRAKIS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain