Report for Sequence Feature Glyma06g10690
Feature Type: gene_model
Chromosome: Gm06
Start: 8088057
stop: 8089434
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g10690
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G64260 AT
Annotation by Michelle Graham. TAIR10: EXORDIUM like 2 | chr5:25703980-25704897 FORWARD LENGTH=305
SoyBase E_val: 7.00E-120 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0046685 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance
SoyBase N/A ISS
GO:0005618 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cell wall
SoyBase N/A ISS
GO:0005794 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0009505 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall
SoyBase N/A ISS
GO:0009506 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF04674 PFAM
Phosphate-induced protein 1 conserved region
JGI ISS
UniRef100_I1K9W7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K9W7_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q7Y0S8 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Erg-1 n=1 Tax=Solanum tuberosum RepID=Q7Y0S8_SOLTU
SoyBase E_val: 2.00E-117 ISS
Expression Patterns of Glyma06g10690
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma06g10690
Paralog Evidence Comments
Glyma04g10860 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g10690 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g101900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g10690
Coding sequences of Glyma06g10690
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g10690.1 sequence type=CDS gene model=Glyma06g10690 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATTATTTTAAGGTTGGCACTTGTTGTGGCCTCCCTTGTAGTACTGGTCCAATCCCATGTTCCAAACATTTGGGAAGCCAAGCCCTTCCATCAGATGTTGTCTTTGGTTCAGCCAGACCCGGTTGTCCTAAACTACCACAAAGGTCCACTCCTTAAGGGAAACGTCACCGTTCACATCCACTGGTACGGTAACTTCACCCCCACTCACCGTTCCATCATCGTTGATTTCATCCAATCCCTCGGTTCCATTCCTCATTCTCGTCACCACCCATCACCTTTTTTGTGGTGGCGAATCACCGCCAGGTACAGAGGAGGCCCCTGCACCCTCACCGTAGGGAATCAAACCCTCGACAACACCTACTCACTCGGTAAATCACTTAAAACAAGCGACCTCCTCGCACTCGCTTCCAAAAATTCACTAACAACAACAACAATTCCCATATCGACTCACAATGAATCTATGCACGTTCTGCTAACCTCTGCTGACGTGGCTGTGGATGGATTCTGCATGAGTCGATGTGGGACCCACGGGTCGGGTAGGGTTCAAAAGAAGAGGTTTGCGTTTGCGTGGGTGGGTAACCCGGCCACGCAGTGCCCCGGGGAGTGCGCGTGGCCGTTCCACCAGCAGGTGTACGGCCCTCAGACTCCGCCGCTCGTTCCGCCGAACGGCGATGTCGGCGTGGACGGAATGGTGATAAGTTTGGCCACCGTTCTCGCCGGCGCGGTAACGAACCCGTTCGGGAACGGGTACTACCAAGGGTCGGCGACGGCGCCGTTGGAGGCGGTGTCGGCGTGTGCCGGGATATTCGGAAAAGGTGCGTATCCGGGCTACACGGGTAACGTTTTGGTGGATAACGTAACGGGAGCTAGCTACAACGCGTTGGATGTGCACGGTCGCAAGTTTCTCTTACCGGCGATGTGGGACCCCGTCACATCTACATGCAAAACGCTCGTTTGA
Predicted protein sequences of Glyma06g10690
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g10690.1 sequence type=predicted peptide gene model=Glyma06g10690 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MIILRLALVVASLVVLVQSHVPNIWEAKPFHQMLSLVQPDPVVLNYHKGPLLKGNVTVHIHWYGNFTPTHRSIIVDFIQSLGSIPHSRHHPSPFLWWRITARYRGGPCTLTVGNQTLDNTYSLGKSLKTSDLLALASKNSLTTTTIPISTHNESMHVLLTSADVAVDGFCMSRCGTHGSGRVQKKRFAFAWVGNPATQCPGECAWPFHQQVYGPQTPPLVPPNGDVGVDGMVISLATVLAGAVTNPFGNGYYQGSATAPLEAVSACAGIFGKGAYPGYTGNVLVDNVTGASYNALDVHGRKFLLPAMWDPVTSTCKTLV*