SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g10490

Feature Type:gene_model
Chromosome:Gm06
Start:7957133
stop:7959717
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g10490
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G09040AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr4:5795075-5797315 REVERSE LENGTH=304 SoyBaseE_val: 4.00E-79ISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
KOG0131 KOG Splicing factor 3b, subunit 4 JGI ISS
PTHR24011Panther FAMILY NOT NAMED JGI ISS
PTHR24011:SF264Panther JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_G7J4G2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Multiple RNA-binding domain-containing protein n=1 Tax=Medicago truncatula RepID=G7J4G2_MEDTR SoyBaseE_val: 3.00E-106ISS
UniRef100_I1K9U6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K9U6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g10490
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g10490
ParalogEvidenceComments
Glyma04g10650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g10490 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g100200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g10490
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g10490
>Glyma06g10490.1   sequence type=CDS   gene model=Glyma06g10490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGCTACTACGTCTTGTTTGCTTACCTTCAACAAATCAATTATCCACTCAACCCCATTCCCATTCCCAATCCACCTCTTTCTCTTTTCTTCGCAAAACGCCCCATTCTCAACCCATCAATTTCAGTCTCTCTTCCTTTCACTTTCCACGCCTATCCCTTATCACAACCAAACAAACCCTTAACCTCACTCCCACACATGCCTCCACTTCCGAACAACAAACCGAGGAGCCTCTTGTCTCTGAAGAAGAATTTTCTCGCACCAGGTTGCTCGCTCAGAACGTGCCCTGGACAAGCACCCCTGAAGACATTCGCACCCTCTTCGAAAAACATGGGAAAGTCCTCGAAGTCGAGCTTTCTATGTATAAGAAAAACCGAAACCGGGGTTTGGCCTTTGTCGAAATGGGTTCCCCAGAAGAGGCACTGGAAGCTCTCAATAATCTCGAATCGTATGAGTTTGAGGGTCGTGTAATTAAAGTCAATTATGCTCGGCCAAAAAAGGAGAAAACAGCGCCGCCCCCTGTGAAACCAAAGGTGGTGACGTTTAACTTGTTTGTTGCTAACTTATCCTATGAAGCAAGCTCCAAAGATCTTAAGGAGTTTTTTGATTTGGGAACTGGTAGAGTTGTCTCTGCTGAGGTTGTGTATCGTGATAATCCTAGAAGGCCGTCTGGATATGGATTTGTGTCCTTCAAGTCTAAGAAAGAAGCTGAGGCTGCTCTTGCTGAGTTCCAAGGAAAGGTTTTTATGGGAAGGCCAATCAGGGTGGATCGGGGTCGGCGTTTTGTTCAACAACCAGGGGACGGGAGTGCAAAGTCTGAAGATACTCCTTCTGAGTTGAGTGTGAATGGGGCAGAAGCTCCACAACCAGCAGAGGGGAGTGCAAAGTCTGAAGATACTCCTTCTGAGTTGAGTGTGAATGGGGAAGAAGCTGACAAAGCTGATTGA
Predicted protein sequences of Glyma06g10490
>Glyma06g10490.1   sequence type=predicted peptide   gene model=Glyma06g10490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALLRLVCLPSTNQLSTQPHSHSQSTSFSFLRKTPHSQPINFSLSSFHFPRLSLITTKQTLNLTPTHASTSEQQTEEPLVSEEEFSRTRLLAQNVPWTSTPEDIRTLFEKHGKVLEVELSMYKKNRNRGLAFVEMGSPEEALEALNNLESYEFEGRVIKVNYARPKKEKTAPPPVKPKVVTFNLFVANLSYEASSKDLKEFFDLGTGRVVSAEVVYRDNPRRPSGYGFVSFKSKKEAEAALAEFQGKVFMGRPIRVDRGRRFVQQPGDGSAKSEDTPSELSVNGAEAPQPAEGSAKSEDTPSELSVNGEEADKAD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo