Glyma06g10450 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g10450

Feature Type:	gene_model
Chromosome:	Gm06
Start:	7916706
stop:	7918636
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g10450

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G40080	AT	Annotation by Michelle Graham. TAIR10: ENTH/ANTH/VHS superfamily protein \| chr4:18579371-18580542 FORWARD LENGTH=365	SoyBase	E_val: 2.00E-57	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005543	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phospholipid binding	SoyBase	N/A	ISS
PTHR22951	Panther	CLATHRIN ASSEMBLY PROTEIN	JGI		ISS
PTHR22951:SF8	Panther	EPSIN N-TERMINAL HOMOLOGY (ENTH) DOMAIN-CONTAINING	JGI		ISS
PF07651	PFAM	ANTH domain	JGI		ISS
UniRef100_B9RJR9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Clathrin assembly protein, putative n=1 Tax=Ricinus communis RepID=B9RJR9_RICCO	SoyBase	E_val: 7.00E-104	ISS
UniRef100_I1K9U2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K9U2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g10450

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g10450

Paralog	Evidence	Comments
Glyma04g10600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g10450 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g099700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g10450

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g10450

Limit To All Plant Sequences

>Glyma06g10450.1   sequence type=CDS   gene model=Glyma06g10450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCCAGCAAAAGCGGTTAAGAGGTCTGGCTCAAAACCTCAAAGACAAAGCCTCGGTGATCGCCGCAGCGCTATCCACCAAGCGTCACCTCTCTTCCGTCCGTGTCCACGTGCTCCGCGCCACCACGCACGCCCTCGCGGCACCACCCTCCGAGGAAACAATTTCTGCTGTCCTCGCGGTCGGGCACGGCGGCTCCCACCGTCATCCACGCGCGTGCATCGACACTCTCATGGACCGCCTCCACACCACGCGCAGTGCCACCGTGGCACTCAAATGCCTCTACACTCTCCACAACGTCGTCGTAAAGGGACCCTTCGTATTGAAAGACCAACTATCTTGTTACCCTTCTTACGGTGGCCACAATTTTCTTAACCTCTCCACCTTCCGAGACGTCTCGGACTTGGAATCGCTCGAACTCAGTTCGTGGGTGCGCTGGTACGCCGCCGTACTGGAACAGACCTTAACCGTTTCAAGAATCTTAGGTTATTACTTGAACGATTCTTGTGAATCCCAAGAAAAAAAGAAGACTTTGGTTGTTTCGAACGCGTCGAATGCGGATTTGTTGTATAAGTTGGAGGTTCTCGTGGGTTTCGTCGAACAAATAAGCCACGTGCCTGATTCGTTGCACCTTCAGAGGAACGAGTTGGTGTACGAGGTTGTGAGATTGGTCGGGGAGAATTATAGGAGCGTTCAAGGTGAGATTTTTTTGCGTGTTGAGGAGCTTGGGGAAAGAATAATGGAGGATTTTGATGTGGGTGAGTTGAACGAGTTGGTGGGGTATTTGGGGAGATTGGAAGAGAGTCGTGAAAAGTTGTTGCTTTTGTTTGTGAATAGAAGAAAGAATAATGGGTTTTGGGAATTGGTTGAGAAGACGAAGGGGAAGGGTGTGGCGAAGAAGAAGGAGATTGAAGGGAAGTGGCTCGCGGTGGTGGTGAGTGGCAACGCCGCCGAGTTGACTCGGTCCACGAACCCGTTTCTTGACCCGGGGCAACAACTCAGTCCGGTCCCCCGGTTAAGTTTTGCAACGGTAAGGTGA

Predicted protein sequences of Glyma06g10450

Limit To All Plant Sequences

>Glyma06g10450.1   sequence type=predicted peptide   gene model=Glyma06g10450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQQKRLRGLAQNLKDKASVIAAALSTKRHLSSVRVHVLRATTHALAAPPSEETISAVLAVGHGGSHRHPRACIDTLMDRLHTTRSATVALKCLYTLHNVVVKGPFVLKDQLSCYPSYGGHNFLNLSTFRDVSDLESLELSSWVRWYAAVLEQTLTVSRILGYYLNDSCESQEKKKTLVVSNASNADLLYKLEVLVGFVEQISHVPDSLHLQRNELVYEVVRLVGENYRSVQGEIFLRVEELGERIMEDFDVGELNELVGYLGRLEESREKLLLLFVNRRKNNGFWELVEKTKGKGVAKKKEIEGKWLAVVVSGNAAELTRSTNPFLDPGQQLSPVPRLSFATVR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain