SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g09923

Feature Type:gene_model
Chromosome:Gm06
Start:7463094
stop:7464170
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g09923
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G64340AT Annotation by Michelle Graham. TAIR10: sequence-specific DNA binding transcription factors;transcription regulators | chr5:25730890-25731936 REVERSE LENGTH=348 SoyBaseE_val: 1.00E-22ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
UniRef100_G7KBG8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor bHLH143 n=1 Tax=Medicago truncatula RepID=G7KBG8_MEDTR SoyBaseE_val: 1.00E-121ISS
UniRef100_UPI0002339F37UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339F37 related cluster n=1 Tax=unknown RepID=UPI0002339F37 SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g09923
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g09923 not represented in the dataset
Glyma06g09923 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g09923
ParalogEvidenceComments
Glyma04g09880 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g09923 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g094700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g09923
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g09923
>Glyma06g09923.1   sequence type=CDS   gene model=Glyma06g09923   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGGAGATTGTGGAACCTGGGCACCACATCTAGAATCACCAAATTTGAATCTCCTTGACACTGGGAAGCCGGTTGGTATTTCTGCAGCTATGAACCCTGGCTTTAATATGGTCTCTAGCAATGCTACGGTGCCTGCTTTCGGATCCTCTACAGTGCCTCATTTGCAGTTAGGACATTCCTATGAACCCAGTGGTTGGTCTTATTGTTTGCCCTGCTTTCCACAGGGATTTGCTCCTGCTCTGAACTTCAATGCTGAGGGAAACCCTCCTGCTGACCATGTAAAAACTTTTGGGGACAAAATTGGTCCCTATGGTGAATCCAGTTCCCTTCAGAAACAAATTCTTGTTATTGATCAGACGGGTGGTCAAACAACTATTGTTTATAGCTCCAGGTTTGGCAGTCCTGGTGAGTGCCTTGCTTCTTGGCATTCAAAACTGCATGGTGCTAACTATTTGAGGGGGAACGAACCTTCTTTCAGAAGAGGTTTGAATTTGAATTTGAACTTGAATATGACTGAGCCAACTTTGGCTGATAAAGTAGATGGGAATCCGGGAACTAGCATTGAAAGTGAGATGCATGAAGACACCGAAGAAATTAATGCATTGCTTTACTCGGACAGCTATGGCTATTCTACCCAGGATGATGATGATGAAGTTACTAGCACAGGGCACTCTCCGAGTACAATGACCACTCATGATAACTGTGAAACCTTTAGGAGGGATACCGCAGAAGAAGTTGCAAGCTCTGCCAGGAAAACCAAGAAGAGGAAGCTATTGGATGGCTATTATGATGACATACAACTCATTGATACTGCCAGTTCTCAGAATCTGAACAAGTCTTCTGCAACGGGAGATGATGACGCAGAATCAAGATGTTCTAGTAACAACAATGAAGGATCCTTGTCTGGCAATAAGAAGATTAAAAAGGAGAAGATACGCGATGTTCTGAGCATTCTGCAGAGCATAATTCCTGGTGGAAAGGATAAGGATCCGGTCATGCTTCTTGACAATGCCATACATTGCTTAAAATCCTTGAAACACAAGGCTCAAGCACTCGGACTTGATGCCTTGTAA
Predicted protein sequences of Glyma06g09923
>Glyma06g09923.1   sequence type=predicted peptide   gene model=Glyma06g09923   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGGDCGTWAPHLESPNLNLLDTGKPVGISAAMNPGFNMVSSNATVPAFGSSTVPHLQLGHSYEPSGWSYCLPCFPQGFAPALNFNAEGNPPADHVKTFGDKIGPYGESSSLQKQILVIDQTGGQTTIVYSSRFGSPGECLASWHSKLHGANYLRGNEPSFRRGLNLNLNLNMTEPTLADKVDGNPGTSIESEMHEDTEEINALLYSDSYGYSTQDDDDEVTSTGHSPSTMTTHDNCETFRRDTAEEVASSARKTKKRKLLDGYYDDIQLIDTASSQNLNKSSATGDDDAESRCSSNNNEGSLSGNKKIKKEKIRDVLSILQSIIPGGKDKDPVMLLDNAIHCLKSLKHKAQALGLDAL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo