Glyma06g09541 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g09541): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g09541): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g09541

Feature Type:	gene_model
Chromosome:	Gm06
Start:	7096656
stop:	7097333
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g09541

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G09960	AT	Annotation by Michelle Graham. TAIR10: sucrose transporter 4 \| chr1:3244258-3246718 FORWARD LENGTH=510	SoyBase	E_val: 2.00E-39	ISS
GO:0015770	GO-bp	Annotation by Michelle Graham. GO Biological Process: sucrose transport	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0005887	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005351	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0008506	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sucrose:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0008515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sucrose transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015144	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity	SoyBase	N/A	ISS
PTHR19432	Panther	SUCROSE TRANSPORT PROTEIN	JGI		ISS
PTHR19432:SF2	Panther	PROSTEIN PROTEIN	JGI		ISS
UniRef100_A3DSX1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Sucrose transport protein SUF4 n=1 Tax=Pisum sativum RepID=A3DSX1_PEA	SoyBase	E_val: 1.00E-47	ISS
UniRef100_UPI000233A4A2	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233A4A2 related cluster n=1 Tax=unknown RepID=UPI000233A4A2	SoyBase	E_val: 5.00E-64	ISS

Expression Patterns of Glyma06g09541

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g09541 not represented in the dataset	Glyma06g09541 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g09541 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g091000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g09541

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g09541

Limit To All Plant Sequences

>Glyma06g09541.1   sequence type=CDS   gene model=Glyma06g09541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAGTGTGCCACAGTACACCGTCTCCAGCGGAACCGCAACCTCTCTCTCTCTCTCCTCCTGGTCTTGCGCGATGCCATGAGGAAACGGTCACAATTCACAACGAGATTGCGAACAAGCTAGAGAGGGACACAGAAGGGGCACGGAATTTGGAATTCAGACACAATGGCGAATCACGGAACCCAACAACATCAACGTCCCCGCCAACACTGCCGGCTAGGGTTCCGCTGAGGCTGCTGCTTCGGGTAGCGTCGGCTGTCGGTGGCATTCAGTTCGGGTGGGCCCTGCAGCTCTCTCTTCTCATGCCGTACGTGCAGCAGCTCGGGATCCCGCACCCCCTGGTGGGCCACTTGAGCGACCGCTGCACCAGCCGCTTCGGCCGCCGAAGACCGTTTATAATGGGCGGAGCATTGCCGATCGTCGTCGCTGTTCTCATCATCGGTCACTCCGCCGACATCGGGTGGTGGTTCGGCGACACCCATGAACATCGCCCCTGGGCTGTCGGAGTTTTTGGCCCATGTAGAGCTTTGCTTGGTGATCTCACTGGTAAATAA

Predicted protein sequences of Glyma06g09541

Limit To All Plant Sequences

>Glyma06g09541.1   sequence type=predicted peptide   gene model=Glyma06g09541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTVCHSTPSPAEPQPLSLSPPGLARCHEETVTIHNEIANKLERDTEGARNLEFRHNGESRNPTTSTSPPTLPARVPLRLLLRVASAVGGIQFGWALQLSLLMPYVQQLGIPHPLVGHLSDRCTSRFGRRRPFIMGGALPIVVAVLIIGHSADIGWWFGDTHEHRPWAVGVFGPCRALLGDLTGK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain