Report for Sequence Feature Glyma06g09500
Feature Type: gene_model
Chromosome: Gm06
Start: 7024384
stop: 7026947
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g09500
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G50010 AT
Annotation by Michelle Graham. TAIR10: tubulin alpha-2 chain | chr1:18517737-18519729 FORWARD LENGTH=450
SoyBase E_val: 0 ISS
GO:0006184 GO-bp
Annotation by Michelle Graham. GO Biological Process: GTP catabolic process
SoyBase N/A ISS
GO:0007017 GO-bp
Annotation by Michelle Graham. GO Biological Process: microtubule-based process
SoyBase N/A ISS
GO:0007018 GO-bp
Annotation by Michelle Graham. GO Biological Process: microtubule-based movement
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0051258 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein polymerization
SoyBase N/A ISS
GO:0005618 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cell wall
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0005874 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: microtubule
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0045298 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: tubulin complex
SoyBase N/A ISS
GO:0003924 GO-mf
Annotation by Michelle Graham. GO Molecular Function: GTPase activity
SoyBase N/A ISS
GO:0005198 GO-mf
Annotation by Michelle Graham. GO Molecular Function: structural molecule activity
SoyBase N/A ISS
GO:0005200 GO-mf
Annotation by Michelle Graham. GO Molecular Function: structural constituent of cytoskeleton
SoyBase N/A ISS
GO:0005525 GO-mf
Annotation by Michelle Graham. GO Molecular Function: GTP binding
SoyBase N/A ISS
KOG1376
KOG
Alpha tubulin
JGI ISS
PTHR11588 Panther
TUBULIN
JGI ISS
PF00091 PFAM
Tubulin/FtsZ family, GTPase domain
JGI ISS
PF03953 PFAM
Tubulin C-terminal domain
JGI ISS
UniRef100_I1K9J7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K9J7_SOYBN
SoyBase E_val: 0 ISS
UniRef100_P46259 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Tubulin alpha-1 chain n=9 Tax=Spermatophyta RepID=TBA1_PEA
SoyBase E_val: 0 ISS
Expression Patterns of Glyma06g09500
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma06g09500
Paralog Evidence Comments
Glyma04g09350 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g09500 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g090500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g09500
Coding sequences of Glyma06g09500
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g09500.1 sequence type=CDS gene model=Glyma06g09500 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGAGAGTGCATTTCAATCCACATTGGTCAGGCCGGTATCCAGGTCGGAAACGCCTGCTGGGAACTCTATTGCCTTGAACACGGCATTCAGCCCGATGGGCAGATGCCGAGTGACAAGACCGTTGGAGGAGGAGACGACGCCTTCAACACATTCTTCAGCGAGACCGGCGCCGGAAAGCACGTGCCTCGCGCCGTCTTCGTGGATCTTGAGCCCACCGTGATCGACGAAGTCCGAACCGGCGCGTACCGGCAGCTCTTCCACCCGGAGCAGCTGATCAGCGGCAAGGAAGACGCCGCCAACAACTTCGCGCGTGGCCACTACACCATCGGAAAGGAGATCGTCGATCTCTGCCTCGACAGGATCCGAAAACTCGCCGACAACTGCACTGGTCTCCAGGGCTTCCTTGTCTTCAACGCCGTCGGTGGCGGCACCGGTTCCGGCTTGGGCTCGCTTCTCTTGGAGCGTCTCTCCGTTGACTACGGGAAAAAGTCAAAGCTCGGTTTCACCGTTTATCCTTCGCCTCAGGTTTCGACCTCGGTGGTGGAACCCTATAACAGCGTCCTTTCAACGCACTCTCTCCTTGAACACACCGATGTTGCCGTGCTTCTTGACAACGAAGCAATCTACGACATTTGCAGGAGATCACTTGACATTGAACGCCCTACCTACACCAACCTTAACCGTCTCGTTTCCCAGGTGATTTCATCCCTCACCGCCTCGTTGAGGTTTGATGGAGCACTGAACGTTGATGTGACTGAGTTCCAAACCAACTTGGTTCCTTACCCTAGGATCCATTTCATGCTTTCCTCATACGCCCCTGTTATCTCTGCTGAGAAAGCATACCATGAACAGCTTTCCGTTGCTGAGATCACCAACAGTGCCTTTGAGCCATCCTCCATGATGGCCAAGTGTGACCCTCGCCACGGCAAGTACATGGCGTGTTGTTTGATGTATCGCGGCGATGTCGTGCCGAAGGATGTGAATGCTGCAGTGGCCACCATCAAGACCAAGAGAACCATCCAGTTTGTGGATTGGTGCCCGACTGGGTTCAAGTGTGGTATAAACTATCAGCCTCCAACCGTTGTTCCTGGAGGTGACCTTGCCAGGGTGCAGAGGGCTGTGTGCATGATTTCTAACTCCACCAGTGTGGCTGAAGTGTTCTCAAGGATTGATCATAAGTTTGATCTCATGTATGCTAAGAGGGCATTCGTGCACTGGTATGTGGGTGAAGGTATGGAAGAGGGTGAGTTCTCGGAGGCTCGTGAGGACCTTGCTGCTCTTGAGAAGGATTATGAGGAGGTTGGTGCCGAGTCTGGTGATGGAGATGATGATGGTGAAGGAGATGATGATTATTAG
Predicted protein sequences of Glyma06g09500
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g09500.1 sequence type=predicted peptide gene model=Glyma06g09500 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MRECISIHIGQAGIQVGNACWELYCLEHGIQPDGQMPSDKTVGGGDDAFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGAYRQLFHPEQLISGKEDAANNFARGHYTIGKEIVDLCLDRIRKLADNCTGLQGFLVFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTVYPSPQVSTSVVEPYNSVLSTHSLLEHTDVAVLLDNEAIYDICRRSLDIERPTYTNLNRLVSQVISSLTASLRFDGALNVDVTEFQTNLVPYPRIHFMLSSYAPVISAEKAYHEQLSVAEITNSAFEPSSMMAKCDPRHGKYMACCLMYRGDVVPKDVNAAVATIKTKRTIQFVDWCPTGFKCGINYQPPTVVPGGDLARVQRAVCMISNSTSVAEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGAESGDGDDDGEGDDDY*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
