SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g08380

Feature Type:gene_model
Chromosome:Gm06
Start:6109060
stop:6113194
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g08380
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G29150AT Annotation by Michelle Graham. TAIR10: non-ATPase subunit 9 | chr1:10181240-10182499 FORWARD LENGTH=419 SoyBaseE_val: 0ISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0030163GO-bp Annotation by Michelle Graham. GO Biological Process: protein catabolic process SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0043161GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0043248GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome assembly SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0051510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of unidimensional cell growth SoyBaseN/AISS
GO:0051604GO-bp Annotation by Michelle Graham. GO Biological Process: protein maturation SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0000502GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome complex SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0008541GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome regulatory particle, lid subcomplex SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
KOG1463 KOG 26S proteasome regulatory complex, subunit RPN6/PSMD11 JGI ISS
PTHR10678Panther 26S PROTEASOME SUBUNIT S9 JGI ISS
PF01399PFAM PCI domain JGI ISS
UniRef100_G7J2W0UniRef Annotation by Michelle Graham. Most informative UniRef hit: 26S proteasome non-ATPase regulatory subunit n=3 Tax=Medicago truncatula RepID=G7J2W0_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K970UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K970_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g08380
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g08380
ParalogEvidenceComments
Glyma04g08280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g08380 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g079600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g08380
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g08380
>Glyma06g08380.1   sequence type=CDS   gene model=Glyma06g08380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTTCCCCTTATCTACCTGCCACAACTGACTCACTTGCTCTCGCAACTGAGGCCAAAGACCCATCTGAGGCCATCTCCATTCTTTATCGGGTGCTTGATGATCCTTCTTCTTCACCAGATGCTCTGCGTATGAAAGAGCAAGCAATCACAAACCTCACTAAGCTTCTCACTGATGAGAATAGGGGAGAGGATCTGCGCAGCCTTCTTACTCAGTTGAGGCCATTCTTCTCCTTGATACCTAAGGCAAAAACTGCAAAGATTGTTAGGGGAATAATTGACTCGGTTGCTAAAATTCCAGGGACATCTGATCTACAAATTGCACTCTGCAAAGAAATGGTGCTGTGGACTCGTGCTGAAAAGCGTACCTTTCTGAGACAGCGAGTTGAGGCAAGGCTTGCAGCACTTCTGATGGAAAGTAAGGAGTATTCAGAAGCTTTGACTCTTCTCTCTGGCTTGGTCAAAGAAGTTAGGAGATTAGATGACAAGCTTCTTCTTGTTGACATAGATTTGCTGGAAAGCAAGCTGCACTTCTCATTAAGAAACCTTCCAAAGGCAAAAGCTGCACTCACGGCTGCAAGAACCGCTGCAAATGCTATATATGTGCCCCCAGCTCAACAAGGTGCCATAGATCTGCAGAGTGGAATACTTCATGCTGAAGAGAAGGATTATAAAACTGCTTATAGTTATTTCTTTGAAGCTTTTGAATCATTCAATGCTCTTGATGACCCCAAGGCTGTTTTTAGCCTGAAGTATATGTTGCTGTGTAAGATCATGGTGAATCAAGCTGATGACGTAGGAGGAATTATTTCTTCTAAAGCAGGCCTGCAATATCTTGGCCCTGACTTGGATGCTATGAAAGCTGTTGCTGATGCACATTCTAAGCGGTCCCTTAATTTGTTTGAAATTGCTTTGAGGGACTACAAGGCACAGTTGGAGGAAGACCCAATTGTACACAGGCACCTTTCATCCTTGTACGATACCCTTATGGAGCAGAATCTCTGCAGGTTGATCGAGCCTTTCTCAAGGGTTGAGATTGCACATATTGCTGAACTTATTGAACTTCCCACGGATCATGTGGAGCGGAAGTTGTCTCAGATGATTTTGGACAAGAAGTTTGCTGGAACATTGGATCAAGGTGCTGGATGCCTTGTCATATTTGACGATCCTAAGACTGATGCTATATATCCTGCTACTCTAGAGACCATTTCCAATGTTGGGAAAGTCGTGGACAGTCTTTACGTTAGGTCTGCCAAGATAATGGCATGA
Predicted protein sequences of Glyma06g08380
>Glyma06g08380.1   sequence type=predicted peptide   gene model=Glyma06g08380   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSPYLPATTDSLALATEAKDPSEAISILYRVLDDPSSSPDALRMKEQAITNLTKLLTDENRGEDLRSLLTQLRPFFSLIPKAKTAKIVRGIIDSVAKIPGTSDLQIALCKEMVLWTRAEKRTFLRQRVEARLAALLMESKEYSEALTLLSGLVKEVRRLDDKLLLVDIDLLESKLHFSLRNLPKAKAALTAARTAANAIYVPPAQQGAIDLQSGILHAEEKDYKTAYSYFFEAFESFNALDDPKAVFSLKYMLLCKIMVNQADDVGGIISSKAGLQYLGPDLDAMKAVADAHSKRSLNLFEIALRDYKAQLEEDPIVHRHLSSLYDTLMEQNLCRLIEPFSRVEIAHIAELIELPTDHVERKLSQMILDKKFAGTLDQGAGCLVIFDDPKTDAIYPATLETISNVGKVVDSLYVRSAKIMA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo