SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g06300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g06300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g06300

Feature Type:gene_model
Chromosome:Gm06
Start:4513586
stop:4515069
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G24930AT Annotation by Michelle Graham. TAIR10: CONSTANS-like 4 | chr5:8589325-8590949 FORWARD LENGTH=406 SoyBaseE_val: 2.00E-110ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG1601 KOG GATA-4/5/6 transcription factors JGI ISS
PF00643PFAM B-box zinc finger JGI ISS
PF06203PFAM CCT motif JGI ISS
UniRef100_C6T776UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=C6T776_SOYBN SoyBaseE_val: 0ISS
UniRef100_G7JPB9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Constans n=1 Tax=Medicago truncatula RepID=G7JPB9_MEDTR SoyBaseE_val: 2.00E-136ISS

LocusGene SymbolProtein Name
COL3b Constans-like 3b

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g06300 not represented in the dataset

Glyma06g06300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma04g06240 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g059600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma06g06300.1   sequence type=CDS   gene model=Glyma06g06300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCAAGCTCTGCGACTCATGCAAATCAGCCACTGCTACCTTGTACTGCCGCCCCGACGCGGCCTTCCTCTGCGGCGCCTGTGACTCTAAGGTTCATGCCGCCAACAAGCTCGCATCGCGCCACCCGCGCGTCGTGCTCTGCGAGGTGTGCGAGCAGGCGCCCGCGCATGTGACCTGTAAAGCCGACGCCGCCGCGCTCTGCCTTGCCTGCGATCGCGATATCCACTCCGCCAACCCCCTCGCCAGCCGCCACGAGCGCATCCCCGTCACGCCGTTCTTCGAGTCCGTACATTCAGTCAAGGCCTCCTCGCCGATCAACTTCCACCACCGCTTCTTCTCCGACGCCGACGCTGATGCTGACGTCAGCACCGAGGAGGCCGAGGCCGCGTCATGGCTGCTACCTAATCCAAAGACAGATCTAAATTCGTCTCAGTACTTGTTCTCCGAAACCGAACCGGTTCCTTACATAGATCTGGATTACGCGGCCATGGATCCGAAGACGGAGCAGAAAAGTTCCGCCACCGCCGACGGCGTCGTTCCGGTGCAGAGCAACTTCGAGCCGTTCACCTACGGTTACAAGTACAACACTACTCTCTCACAGTCACAGTCTCATATGAGCCAGAGTGTATCTTCTCCGTCGTCGATGGAAGTTGGAGTTGTGCCGGACGGGAACACGATGTCGGAGATATCGAACTGCAGCTACAGCAAAGTGGCACCGGTGACGGTGACGGCGCAGTTCTCGGCGGCGGATAGGGAGGCTAGAGTGTTGAGGTACAGGGAGAAGAGGAAGAACCGAAAGTTCGAGAAGACCATTCGTTACGCATCGAGAAAAGCGTATGCCGAAACGAGGCCAAGAATCAAAGGAAGGTTCGCGAAACGCACTGATGCGGACCCTCTGGCTGGATACGGCGTCGTTCCGTCGTGTTGA

>Glyma06g06300.1   sequence type=predicted peptide   gene model=Glyma06g06300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASKLCDSCKSATATLYCRPDAAFLCGACDSKVHAANKLASRHPRVVLCEVCEQAPAHVTCKADAAALCLACDRDIHSANPLASRHERIPVTPFFESVHSVKASSPINFHHRFFSDADADADVSTEEAEAASWLLPNPKTDLNSSQYLFSETEPVPYIDLDYAAMDPKTEQKSSATADGVVPVQSNFEPFTYGYKYNTTLSQSQSHMSQSVSSPSSMEVGVVPDGNTMSEISNCSYSKVAPVTVTAQFSAADREARVLRYREKRKNRKFEKTIRYASRKAYAETRPRIKGRFAKRTDADPLAGYGVVPSC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo