Glyma06g05770 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g05770

Feature Type:	gene_model
Chromosome:	Gm06
Start:	4126989
stop:	4132412
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g05770

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G12040	AT	Annotation by Michelle Graham. TAIR10: Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein \| chr5:3885162-3887772 FORWARD LENGTH=369	SoyBase	E_val: 0	ISS
GO:0006807	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrogen compound metabolic process	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0016810	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds	SoyBase	N/A	ISS
KOG0806	KOG	Carbon-nitrogen hydrolase	JGI		ISS
PTHR23088	Panther	NITRILASE-RELATED	JGI		ISS
PF00795	PFAM	Carbon-nitrogen hydrolase	JGI		ISS
UniRef100_G7J8D4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Omega-amidase NIT2 n=1 Tax=Medicago truncatula RepID=G7J8D4_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1K8F4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K8F4_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma06g05770

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g05770

Paralog	Evidence	Comments
Glyma04g05770	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g05770 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g055100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g05770

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g05770

Limit To All Plant Sequences

>Glyma06g05770.1   sequence type=CDS   gene model=Glyma06g05770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAGCATCCGCACTGCTTAACTTGAAATCTTTCACTCTCAGCCGCCATTCTCCCACTTCCAACTCCTTCTTCCCCCCCTTTCTTTGTCCATCCCACCCCCGCCACCGCCGAATCCACCACTCTCGAAATCCAATCATGTCTGCCACATCCGTCAACTCCGAACGAGCACGCGCCCCTCCCGCCATTCCCTTGCCCCCTCCCCCTCTCTCCAACTTCAAAATTGGCCTCTGTCAACTCTCCGTCAGCCCCGACAAAGACAGCAACATCGCCCACGCTCGCACCGCCATTCAGGATGCTGCATCAAAGGGCGCCCAGCTTGTTCTTTTGCCCGAAATTTGGAACAGTCCTTATTCCAACGATAGTTTTCCTGTCTACGCTGAGGATATTGACGCTGGTGCTTCTCCTTCCACTGCCATGCTATCTGAACTCTCTCGTCTCTTGAAAATCACCATAGTTGGTGGTTCCATTCCAGAACGCTCTGGAGGTCTCTTGTACAACACTTGCTGCGTCTTTGGCACCGACGGAAACCTACTAGCCAAGCACCGCAAGATACATCTTTTTGATATTGACATCCCTGGGAAGATTACTTTTATTGAATCAAAAACTCTTACTGCTGGGGAGACTCCGACAATTGTGGACACAGAGGTTGGACGCATTGGCATAGGCATCTGTTATGACATTCGATTTCCAGAACTAGCAATGATATATGCTGCTAGAGGTGCTCACTTACTCTGCTACCCTGGGGCATTTAACATGACAACTGGACCATTACATTGGGAGTTATTGCAGAGGGCAAGGGCTACAGATAATCAGTTATATGTGGCTACCTGTTCACCTGCCCGGGATACTGGATCTGGTTATGTGGCTTGGGGCCACTCCACTCTTGTTGGACCATTTGGAGAAGTTCTGGCTACTACAGAACATGAGGAGGCAATCATCATAGCAGAAATTGATTATTCAATATTGGAGCAGAGAAGGACAAATCTGCCTGTAACTAAGCAAAGGCGAGGTGATCTTTACCAGTTGGTGGATTTTCAGAGGCTGAATTCTCAGTGA

Predicted protein sequences of Glyma06g05770

Limit To All Plant Sequences

>Glyma06g05770.1   sequence type=predicted peptide   gene model=Glyma06g05770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKASALLNLKSFTLSRHSPTSNSFFPPFLCPSHPRHRRIHHSRNPIMSATSVNSERARAPPAIPLPPPPLSNFKIGLCQLSVSPDKDSNIAHARTAIQDAASKGAQLVLLPEIWNSPYSNDSFPVYAEDIDAGASPSTAMLSELSRLLKITIVGGSIPERSGGLLYNTCCVFGTDGNLLAKHRKIHLFDIDIPGKITFIESKTLTAGETPTIVDTEVGRIGIGICYDIRFPELAMIYAARGAHLLCYPGAFNMTTGPLHWELLQRARATDNQLYVATCSPARDTGSGYVAWGHSTLVGPFGEVLATTEHEEAIIIAEIDYSILEQRRTNLPVTKQRRGDLYQLVDFQRLNSQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain