SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g05660

Feature Type:gene_model
Chromosome:Gm06
Start:4047464
stop:4050092
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g05660
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G33090AT Annotation by Michelle Graham. TAIR10: aminopeptidase M1 | chr4:15965915-15970418 REVERSE LENGTH=879 SoyBaseE_val: 8.00E-34ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0010359GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of anion channel activity SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0004177GO-mf Annotation by Michelle Graham. GO Molecular Function: aminopeptidase activity SoyBaseN/AISS
GO:0008237GO-mf Annotation by Michelle Graham. GO Molecular Function: metallopeptidase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR11533Panther PROTEASE M1 ZINC METALLOPROTEASE JGI ISS
PTHR11533:SF97Panther JGI ISS
UniRef100_G7J8C0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Puromycin-sensitive aminopeptidase n=1 Tax=Medicago truncatula RepID=G7J8C0_MEDTR SoyBaseE_val: 4.00E-43ISS
UniRef100_UPI000233A42CUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A42C related cluster n=1 Tax=unknown RepID=UPI000233A42C SoyBaseE_val: 1.00E-70ISS

Expression Patterns of Glyma06g05660
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g05660 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g053900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g05660
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g05660
>Glyma06g05660.1   sequence type=CDS   gene model=Glyma06g05660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTATTATGTTCAGAGAAAAAATGACAGTCACAATTCTTGTCAAGCGGTGCTCAACGAGAAGGCCATTGGACTGTTCCAATAACATTATGCTTTGGCTCTTACATGACGACCACAAGAGTTTCCTCTTGCAAACAAAATCTGAAACACATGATGTCAAAGAGTTCCTTGGTTCCACAGACAAAGGTGTGAATTGTTGGATTAAACTTAATGTGGATCAGGCTGGTTTCTACAGGGTGAAGTATGATGAGCTGCTTGCTGCTAGACTTAGATATGCAGTAGAGAAACAACTCTTATCTGCATCAGACCGATTTGGTAAATTAGATATTCACTTGAAAATTTATTTCCAATGGGAGGAAGTTGATTATACCGTGCTGTCTAACCAGATGAATGTAAAGAGGCTTGGTTGGGAGACTAAACCAGGAGAAAGTCATCTAGATGCTATGTCGAGAGGAGAAATTTTGAATGCCCTTGCTGTGTTTGGTCATGATTTGACACTGGATGAAGCAAGCTCTCTGTCATCTTCACGTGATCCAGATCTAATTCTTGAAGCTCTTTTATGTTGTCATCTGAGTCAGGATGCTGTTTGTGGACTTGCTGTTGTTACTCGGGAAGGACGAGATGTAGCTTGGTCATGGCTTTAG
Predicted protein sequences of Glyma06g05660
>Glyma06g05660.1   sequence type=predicted peptide   gene model=Glyma06g05660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIIMFREKMTVTILVKRCSTRRPLDCSNNIMLWLLHDDHKSFLLQTKSETHDVKEFLGSTDKGVNCWIKLNVDQAGFYRVKYDELLAARLRYAVEKQLLSASDRFGKLDIHLKIYFQWEEVDYTVLSNQMNVKRLGWETKPGESHLDAMSRGEILNALAVFGHDLTLDEASSLSSSRDPDLILEALLCCHLSQDAVCGLAVVTREGRDVAWSWL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo