Glyma06g05660 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g05660): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g05660): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g05660

Feature Type:	gene_model
Chromosome:	Gm06
Start:	4047464
stop:	4050092
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma06g05660

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G33090	AT	Annotation by Michelle Graham. TAIR10: aminopeptidase M1 \| chr4:15965915-15970418 REVERSE LENGTH=879	SoyBase	E_val: 8.00E-34	ISS
GO:0006094	GO-bp	Annotation by Michelle Graham. GO Biological Process: gluconeogenesis	SoyBase	N/A	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0007010	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization	SoyBase	N/A	ISS
GO:0009926	GO-bp	Annotation by Michelle Graham. GO Biological Process: auxin polar transport	SoyBase	N/A	ISS
GO:0010359	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of anion channel activity	SoyBase	N/A	ISS
GO:0010498	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0004177	GO-mf	Annotation by Michelle Graham. GO Molecular Function: aminopeptidase activity	SoyBase	N/A	ISS
GO:0008237	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metallopeptidase activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PTHR11533	Panther	PROTEASE M1 ZINC METALLOPROTEASE	JGI		ISS
PTHR11533:SF97	Panther		JGI		ISS
UniRef100_G7J8C0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Puromycin-sensitive aminopeptidase n=1 Tax=Medicago truncatula RepID=G7J8C0_MEDTR	SoyBase	E_val: 4.00E-43	ISS
UniRef100_UPI000233A42C	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233A42C related cluster n=1 Tax=unknown RepID=UPI000233A42C	SoyBase	E_val: 1.00E-70	ISS

Expression Patterns of Glyma06g05660

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g05660 not represented in the dataset	Glyma06g05660 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g05660 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.06g053900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma06g05660

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma06g05660

Limit To All Plant Sequences

>Glyma06g05660.1   sequence type=CDS   gene model=Glyma06g05660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTATTATGTTCAGAGAAAAAATGACAGTCACAATTCTTGTCAAGCGGTGCTCAACGAGAAGGCCATTGGACTGTTCCAATAACATTATGCTTTGGCTCTTACATGACGACCACAAGAGTTTCCTCTTGCAAACAAAATCTGAAACACATGATGTCAAAGAGTTCCTTGGTTCCACAGACAAAGGTGTGAATTGTTGGATTAAACTTAATGTGGATCAGGCTGGTTTCTACAGGGTGAAGTATGATGAGCTGCTTGCTGCTAGACTTAGATATGCAGTAGAGAAACAACTCTTATCTGCATCAGACCGATTTGGTAAATTAGATATTCACTTGAAAATTTATTTCCAATGGGAGGAAGTTGATTATACCGTGCTGTCTAACCAGATGAATGTAAAGAGGCTTGGTTGGGAGACTAAACCAGGAGAAAGTCATCTAGATGCTATGTCGAGAGGAGAAATTTTGAATGCCCTTGCTGTGTTTGGTCATGATTTGACACTGGATGAAGCAAGCTCTCTGTCATCTTCACGTGATCCAGATCTAATTCTTGAAGCTCTTTTATGTTGTCATCTGAGTCAGGATGCTGTTTGTGGACTTGCTGTTGTTACTCGGGAAGGACGAGATGTAGCTTGGTCATGGCTTTAG

Predicted protein sequences of Glyma06g05660

Limit To All Plant Sequences

>Glyma06g05660.1   sequence type=predicted peptide   gene model=Glyma06g05660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIIMFREKMTVTILVKRCSTRRPLDCSNNIMLWLLHDDHKSFLLQTKSETHDVKEFLGSTDKGVNCWIKLNVDQAGFYRVKYDELLAARLRYAVEKQLLSASDRFGKLDIHLKIYFQWEEVDYTVLSNQMNVKRLGWETKPGESHLDAMSRGEILNALAVFGHDLTLDEASSLSSSRDPDLILEALLCCHLSQDAVCGLAVVTREGRDVAWSWL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain