SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma06g03101): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma06g03101): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma06g03101

Feature Type:gene_model
Chromosome:Gm06
Start:2175653
stop:2179127
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g03101
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G27190AT Annotation by Michelle Graham. TAIR10: purple acid phosphatase 12 | chr2:11621400-11623438 REVERSE LENGTH=469 SoyBaseE_val: 2.00E-80ISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0003993GO-mf Annotation by Michelle Graham. GO Molecular Function: acid phosphatase activity SoyBaseN/AISS
GO:0004722GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
PTHR22953Panther ACID PHOSPHATASE RELATED JGI ISS
UniRef100_E6NU63UniRef Annotation by Michelle Graham. Most informative UniRef hit: JHL18I08.7 protein n=1 Tax=Jatropha curcas RepID=E6NU63_9ROSI SoyBaseE_val: 8.00E-81ISS
UniRef100_UPI000233A60DUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A60D related cluster n=1 Tax=unknown RepID=UPI000233A60D SoyBaseE_val: 2.00E-105ISS

Expression Patterns of Glyma06g03101
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g03101 not represented in the dataset
Glyma06g03101 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma06g03101 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma06g03101
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g03101
>Glyma06g03101.1   sequence type=CDS   gene model=Glyma06g03101   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATAGTCCAATGTATAATAGTTATGTGAATCACTATATGGAAGGGGAGACCGTTAGAGTATTGTACGAGAAATGGTTTGTGGAATATAAAGTCGATGTTGTATTTGCTGGTCACGTTCACGCTTATGAACGATCTAAACGGGTATCAAATATTGCATATAGTATTGTAAATGGGTTGCACAACCCCATCAATGACCAATCTGCTCCAGTTTACATAACGATTGGAGATGGAGGAAATATAGAAGGACTGGCTACTGCTATGACAGAGCCCCAGCCAAGCTATTCAGCATACCGTGAAGCCAGTTTTGGGCATGGCATTCTTGATATAAAGAACAGAACTCATGCCTATTTTAGTTGGAATCGGAATCAAGATGGGTATGCAGTGGTGGCTGATTCCATTTGGTTGTACAATAGATATTGGACCCACCCAGAACAAACATCTCTTGCATTATTTCGGTAG
Predicted protein sequences of Glyma06g03101
>Glyma06g03101.1   sequence type=predicted peptide   gene model=Glyma06g03101   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHSPMYNSYVNHYMEGETVRVLYEKWFVEYKVDVVFAGHVHAYERSKRVSNIAYSIVNGLHNPINDQSAPVYITIGDGGNIEGLATAMTEPQPSYSAYREASFGHGILDIKNRTHAYFSWNRNQDGYAVVADSIWLYNRYWTHPEQTSLALFR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo