SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g02921

Feature Type:gene_model
Chromosome:Gm06
Start:2024052
stop:2028566
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g02921
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G24160AT Annotation by Michelle Graham. TAIR10: alpha/beta-Hydrolases superfamily protein | chr4:12539871-12542210 FORWARD LENGTH=418 SoyBaseE_val: 2.00E-121ISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0052542GO-bp Annotation by Michelle Graham. GO Biological Process: defense response by callose deposition SoyBaseN/AISS
GO:0055088GO-bp Annotation by Michelle Graham. GO Biological Process: lipid homeostasis SoyBaseN/AISS
GO:0055089GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid homeostasis SoyBaseN/AISS
GO:0055091GO-bp Annotation by Michelle Graham. GO Biological Process: phospholipid homeostasis SoyBaseN/AISS
GO:0070328GO-bp Annotation by Michelle Graham. GO Biological Process: triglyceride homeostasis SoyBaseN/AISS
GO:0004623GO-mf Annotation by Michelle Graham. GO Molecular Function: phospholipase A2 activity SoyBaseN/AISS
GO:0016298GO-mf Annotation by Michelle Graham. GO Molecular Function: lipase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0042171GO-mf Annotation by Michelle Graham. GO Molecular Function: lysophosphatidic acid acyltransferase activity SoyBaseN/AISS
PTHR10992Panther ALPHA/BETA HYDROLASE RELATED JGI ISS
PTHR10992:SF273Panther ABHYDROLASE DOMAIN CONTAINING 5-RELATED JGI ISS
PF00561PFAM alpha/beta hydrolase fold JGI ISS
UniRef100_G7J4P3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 1-acylglycerol-3-phosphate O-acyltransferase ABHD5 n=1 Tax=Medicago truncatula RepID=G7J4P3_MEDTR SoyBaseE_val: 9.00E-120ISS
UniRef100_I1K7L8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K7L8_SOYBN SoyBaseE_val: 1.00E-149ISS

Expression Patterns of Glyma06g02921
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma06g02921 not represented in the dataset
Glyma06g02921 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g02921
ParalogEvidenceComments
Glyma04g02900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g02921 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma06g02921
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g02921
>Glyma06g02921.1   sequence type=CDS   gene model=Glyma06g02921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAATGTCACGTGCTCAGGCTCATCGCAACGATCGTCACGTGTTTTTTTGCGGAGATGGTCGGTTTGGGAAATTTTTAAAATTGTTTTTTTTTTGTCGGGTTAGACGGAGAGGACGCCGGCGATGCTGCTACGGTGGTGAGGCGGACGGAAACGGAAGGAGTAAGAGAGGAGGAAGTGGGACTGGTTATGTTCAAGAGCATGTTAACATTGGCTCTGATCCTCCTGGCTCCAAAGTGAGATGGTTCCGTTCATCCAAAGCATGGTTCATTGATTCTTTTGATGAATGGAGAAAAGCCAAAAACTTGAGCAATTTTATACTACTTGGACATTCTTTTGGTGGTTATGTTGCTGCCAAATATGCGCTCAAGCACCCTCAGCATGTACAACACTTGATTCTGGTTGGATCTGCTGGATTTTCATCAGAATCAGATGCAAAGTCTGAGTGGATTACAAGGTTTTCAACAACATGGAAGGGAACAGTTTTGAACCATCTACGGGAATCAAATTTCACACCTCAGAAACTTGTCAGGGGTTTAGGTCCTTGGGGTCCCAACATTGTCCCCAAGTATACAAGTACTAGGTTTGGTACACATTCAACTGGGGAAATACTGACTGAAGAGGAATCAGCATTGCTGATTGATATATGGGATAAATACGATGTTTACCACACATTGGCCGCCAAAGCTACTGGAGAGCTGTGCTTAAAATATATTTTTTCATTTGGAGCATTTGCTAGGATGCCCCTTCTTCTCAGTTTGTGGAAGGTGCCCACCACTTTCATATATGGTTTCCAAGACTGGATGAATTATCAAGGTGCCCAAGAAGCTCGCAAGCATATGAAGGTTCCATGCGAAATCATCAGGGTTCCTCAGGGTGGGCACTTTGCGTTCTTGACAATCCAACTGCCTTCCATTCAGCTGTTTTTTATGCTTGTGGAAGGTTTCTTACACCTGATCCAGACAATGAATCTCTTCCTCAAAGGGCTAACCTCTGCATAG
Predicted protein sequences of Glyma06g02921
>Glyma06g02921.1   sequence type=predicted peptide   gene model=Glyma06g02921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGMSRAQAHRNDRHVFFCGDGRFGKFLKLFFFCRVRRRGRRRCCYGGEADGNGRSKRGGSGTGYVQEHVNIGSDPPGSKVRWFRSSKAWFIDSFDEWRKAKNLSNFILLGHSFGGYVAAKYALKHPQHVQHLILVGSAGFSSESDAKSEWITRFSTTWKGTVLNHLRESNFTPQKLVRGLGPWGPNIVPKYTSTRFGTHSTGEILTEEESALLIDIWDKYDVYHTLAAKATGELCLKYIFSFGAFARMPLLLSLWKVPTTFIYGFQDWMNYQGAQEARKHMKVPCEIIRVPQGGHFAFLTIQLPSIQLFFMLVEGFLHLIQTMNLFLKGLTSA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo