SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g02760

Feature Type:gene_model
Chromosome:Gm06
Start:1860812
stop:1866699
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g02760
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G75680AT Annotation by Michelle Graham. TAIR10: glycosyl hydrolase 9B7 | chr1:28417215-28419231 REVERSE LENGTH=525 SoyBaseE_val: 0ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0000272GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide catabolic process SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0005982GO-bp Annotation by Michelle Graham. GO Biological Process: starch metabolic process SoyBaseN/AISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0008361GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell size SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0009736GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010015GO-bp Annotation by Michelle Graham. GO Biological Process: root morphogenesis SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0040007GO-bp Annotation by Michelle Graham. GO Biological Process: growth SoyBaseN/AISS
GO:0042546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048653GO-bp Annotation by Michelle Graham. GO Biological Process: anther development SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
PTHR22298Panther ENDO-1,4-BETA-GLUCANASE JGI ISS
PF00759PFAM Glycosyl hydrolase family 9 JGI ISS
UniRef100_G7J4Q1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Endoglucanase n=1 Tax=Medicago truncatula RepID=G7J4Q1_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K7K4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K7K4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma06g02760
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g02760
ParalogEvidenceComments
Glyma04g02740 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g02760 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g025100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g02760
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g02760
>Glyma06g02760.1   sequence type=CDS   gene model=Glyma06g02760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGAAAAATCGAGGTCCAAAGGAGGGTGCTGCGGTTGGTTCATCGCGTTCGTCATTCTGGCTCTCGTCGTCGGTGCCATTGTTTTTACCGTTAAGAAGAAATTTAGTCACTCCGGTTCCGATAAGCCTGCTCCTGTTCCCGGTCCCCCTGGCGCCGTTGACCAAAAATACTCCACTGCACTCAAAACCGCAATGCAATTCTTCGATGTTCAGAAATCTGGGAGGTTAGTTGACAATAAAATATCTTGGAGAGGGAATTCGGCTCTTAAGGATGGGAGCCAAGCGAAGTTGGATCTATCAAAAGGGATGTATGATGCTGGGGATAACATGAAGTTTGGTTTTCCGATGGCTTTTACGGCCACGGTGCTGTCTTGGTCCATTCTGGAATATGGAGATCAAATGGATCACGTTGGCCAGTTAGACGCCGCTCAGGATTCGCTCAAGTGGATCACTGATTTTCTCATCAATGCTCACCCTTCTGAGAATGTTCTTTATATTCAGGTGGGTGATCCTGTTGCAGATCACAAGTGTTGGGAAAAACCAGAAGCCATGACTGAGGAACGTCCACTCTTACAAGTGAATGCATCTTGTCCAGGATCAGACATTGCAGCTGAAACTGCAGCAGCCATGGCCTCAGCTTCTTTGGTCTTTAAAAAGACTGATCCTACATATTCAAGCACTCTCCTCAAGCATGCAAAACAGTTGTTTACTTTTGCTGACAAGAATAGAGGATCTTATAGTGAGAATATACCCGAAGTTGCGACATATTATAACTCAACTGGATATGGTGATGAGCTTTTATGGGCTGCTAGCTGGCTCTATCATGCTACGGGTGATGATTCTTACCTTCAGTTTGTGACTGGCCAAGATGGGGAAGACTATGCTCAATGGGGAAGCCCAACCTGGTTCAGTTGGGATAACAAGCTTGCTGGAACTCAGGTTTTGTTATCTAGATTAAGCTTTTTTAAGGCAAAGGACATTTCAAATTCGTATAGCTCTGGGCTCCATAGTTACAGGAAAACTGCTGAGGCTGTAATGTGTGGTCTTCTTCCGGATTCTCCAACAGCCACAAAAAGCAGAACAGATGATGGTCTTATATGGGTGAGTCAATGGAACTCTTTGCAACATCCTGTTGCATCTGCATTCTTAGCTGCTGTTTACAGTGACTATATGCTAACATCGCAGACACCAAAACTAAAATGTGATTCAGATTCCTTTACCCCATCAGATCTTCGAGACTTTGCCAAATCTCAGGCTGATTACGTATTGGGCAAGAATCCTATGCATATGAGTTTTCTGGTGGGCTATGGAGATAAATACCCACAATTTGTGCATCATAGGGGTGCTTCAATTCCTGCTGATGCAAAAACTGGCTGCAAGGATGGCTTCCAGTGGCTTGAATCATCTGATCCTAATCCCAATGTAGCTACTGGAGCACTTGTTGGTGGACCCTTCTTAAATGAGACTTTCATTGATTCCAGGAACAATTCCATGCAAACAGAACCAAGCACGTACAACAGTGCTGTCATAGTCGGTCTCTTATCAAGTTTAGTCACCACGTCTTCTGCCGTTCAATCCTTTACCTAA
Predicted protein sequences of Glyma06g02760
>Glyma06g02760.1   sequence type=predicted peptide   gene model=Glyma06g02760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGEKSRSKGGCCGWFIAFVILALVVGAIVFTVKKKFSHSGSDKPAPVPGPPGAVDQKYSTALKTAMQFFDVQKSGRLVDNKISWRGNSALKDGSQAKLDLSKGMYDAGDNMKFGFPMAFTATVLSWSILEYGDQMDHVGQLDAAQDSLKWITDFLINAHPSENVLYIQVGDPVADHKCWEKPEAMTEERPLLQVNASCPGSDIAAETAAAMASASLVFKKTDPTYSSTLLKHAKQLFTFADKNRGSYSENIPEVATYYNSTGYGDELLWAASWLYHATGDDSYLQFVTGQDGEDYAQWGSPTWFSWDNKLAGTQVLLSRLSFFKAKDISNSYSSGLHSYRKTAEAVMCGLLPDSPTATKSRTDDGLIWVSQWNSLQHPVASAFLAAVYSDYMLTSQTPKLKCDSDSFTPSDLRDFAKSQADYVLGKNPMHMSFLVGYGDKYPQFVHHRGASIPADAKTGCKDGFQWLESSDPNPNVATGALVGGPFLNETFIDSRNNSMQTEPSTYNSAVIVGLLSSLVTTSSAVQSFT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo